ID: 1104584041

View in Genome Browser
Species Human (GRCh38)
Location 12:130033326-130033348
Sequence CTGTCTAAGGGGCTCTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104584032_1104584041 22 Left 1104584032 12:130033281-130033303 CCTGTATAGGAAAGATGAATTGC No data
Right 1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104584041 Original CRISPR CTGTCTAAGGGGCTCTTGGA TGG Intergenic
No off target data available for this crispr