ID: 1104584819

View in Genome Browser
Species Human (GRCh38)
Location 12:130039517-130039539
Sequence TTTATAAATTATCCAGTATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104584819_1104584826 18 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584826 12:130039558-130039580 CTCACAGTTCCCCAGGGCTGGGG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
1104584819_1104584823 12 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584823 12:130039552-130039574 AATTGACTCACAGTTCCCCAGGG 0: 54
1: 2317
2: 7147
3: 7817
4: 7208
1104584819_1104584827 21 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584827 12:130039561-130039583 ACAGTTCCCCAGGGCTGGGGAGG 0: 5
1: 228
2: 4906
3: 8932
4: 8764
1104584819_1104584830 28 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584830 12:130039568-130039590 CCCAGGGCTGGGGAGGCCTCAGG No data
1104584819_1104584824 16 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG 0: 5
1: 251
2: 3897
3: 9101
4: 8936
1104584819_1104584825 17 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584825 12:130039557-130039579 ACTCACAGTTCCCCAGGGCTGGG 0: 7
1: 282
2: 4254
3: 9482
4: 9076
1104584819_1104584822 11 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584822 12:130039551-130039573 TAATTGACTCACAGTTCCCCAGG 0: 14
1: 717
2: 1917
3: 2790
4: 3509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104584819 Original CRISPR TTTATAAATTATCCAGTATC CGG (reversed) Intergenic
No off target data available for this crispr