ID: 1104584824

View in Genome Browser
Species Human (GRCh38)
Location 12:130039556-130039578
Sequence GACTCACAGTTCCCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22190
Summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104584819_1104584824 16 Left 1104584819 12:130039517-130039539 CCGGATACTGGATAATTTATAAA No data
Right 1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG 0: 5
1: 251
2: 3897
3: 9101
4: 8936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104584824 Original CRISPR GACTCACAGTTCCCCAGGGC TGG Intergenic
Too many off-targets to display for this crispr