ID: 1104584824 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:130039556-130039578 |
| Sequence | GACTCACAGTTCCCCAGGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 22190 | |||
| Summary | {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104584819_1104584824 | 16 | Left | 1104584819 | 12:130039517-130039539 | CCGGATACTGGATAATTTATAAA | No data | ||
| Right | 1104584824 | 12:130039556-130039578 | GACTCACAGTTCCCCAGGGCTGG | 0: 5 1: 251 2: 3897 3: 9101 4: 8936 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104584824 | Original CRISPR | GACTCACAGTTCCCCAGGGC TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||