ID: 1104587923

View in Genome Browser
Species Human (GRCh38)
Location 12:130062510-130062532
Sequence CCAAGGCTGCACAGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3392
Summary {0: 22, 1: 140, 2: 432, 3: 1052, 4: 1746}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587923_1104587936 28 Left 1104587923 12:130062510-130062532 CCCCCTGCTCTGTGCAGCCTTGG 0: 22
1: 140
2: 432
3: 1052
4: 1746
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data
1104587923_1104587935 20 Left 1104587923 12:130062510-130062532 CCCCCTGCTCTGTGCAGCCTTGG 0: 22
1: 140
2: 432
3: 1052
4: 1746
Right 1104587935 12:130062553-130062575 AGCTGCTTCAGCTCCCGTCTTGG No data
1104587923_1104587937 29 Left 1104587923 12:130062510-130062532 CCCCCTGCTCTGTGCAGCCTTGG 0: 22
1: 140
2: 432
3: 1052
4: 1746
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587923_1104587938 30 Left 1104587923 12:130062510-130062532 CCCCCTGCTCTGTGCAGCCTTGG 0: 22
1: 140
2: 432
3: 1052
4: 1746
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587923 Original CRISPR CCAAGGCTGCACAGAGCAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr