ID: 1104587925

View in Genome Browser
Species Human (GRCh38)
Location 12:130062511-130062533
Sequence CCCAAGGCTGCACAGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3506
Summary {0: 52, 1: 149, 2: 469, 3: 1161, 4: 1675}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587925_1104587937 28 Left 1104587925 12:130062511-130062533 CCCCTGCTCTGTGCAGCCTTGGG 0: 52
1: 149
2: 469
3: 1161
4: 1675
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587925_1104587938 29 Left 1104587925 12:130062511-130062533 CCCCTGCTCTGTGCAGCCTTGGG 0: 52
1: 149
2: 469
3: 1161
4: 1675
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587925_1104587935 19 Left 1104587925 12:130062511-130062533 CCCCTGCTCTGTGCAGCCTTGGG 0: 52
1: 149
2: 469
3: 1161
4: 1675
Right 1104587935 12:130062553-130062575 AGCTGCTTCAGCTCCCGTCTTGG No data
1104587925_1104587936 27 Left 1104587925 12:130062511-130062533 CCCCTGCTCTGTGCAGCCTTGGG 0: 52
1: 149
2: 469
3: 1161
4: 1675
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587925 Original CRISPR CCCAAGGCTGCACAGAGCAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr