ID: 1104587927

View in Genome Browser
Species Human (GRCh38)
Location 12:130062512-130062534
Sequence TCCCAAGGCTGCACAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2605
Summary {0: 31, 1: 125, 2: 617, 3: 827, 4: 1005}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587927_1104587938 28 Left 1104587927 12:130062512-130062534 CCCTGCTCTGTGCAGCCTTGGGA 0: 31
1: 125
2: 617
3: 827
4: 1005
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587927_1104587935 18 Left 1104587927 12:130062512-130062534 CCCTGCTCTGTGCAGCCTTGGGA 0: 31
1: 125
2: 617
3: 827
4: 1005
Right 1104587935 12:130062553-130062575 AGCTGCTTCAGCTCCCGTCTTGG No data
1104587927_1104587937 27 Left 1104587927 12:130062512-130062534 CCCTGCTCTGTGCAGCCTTGGGA 0: 31
1: 125
2: 617
3: 827
4: 1005
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587927_1104587936 26 Left 1104587927 12:130062512-130062534 CCCTGCTCTGTGCAGCCTTGGGA 0: 31
1: 125
2: 617
3: 827
4: 1005
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587927 Original CRISPR TCCCAAGGCTGCACAGAGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr