ID: 1104587928

View in Genome Browser
Species Human (GRCh38)
Location 12:130062513-130062535
Sequence GTCCCAAGGCTGCACAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1565
Summary {0: 25, 1: 115, 2: 322, 3: 452, 4: 651}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587928_1104587936 25 Left 1104587928 12:130062513-130062535 CCTGCTCTGTGCAGCCTTGGGAC 0: 25
1: 115
2: 322
3: 452
4: 651
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data
1104587928_1104587938 27 Left 1104587928 12:130062513-130062535 CCTGCTCTGTGCAGCCTTGGGAC 0: 25
1: 115
2: 322
3: 452
4: 651
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587928_1104587937 26 Left 1104587928 12:130062513-130062535 CCTGCTCTGTGCAGCCTTGGGAC 0: 25
1: 115
2: 322
3: 452
4: 651
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587928_1104587935 17 Left 1104587928 12:130062513-130062535 CCTGCTCTGTGCAGCCTTGGGAC 0: 25
1: 115
2: 322
3: 452
4: 651
Right 1104587935 12:130062553-130062575 AGCTGCTTCAGCTCCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587928 Original CRISPR GTCCCAAGGCTGCACAGAGC AGG (reversed) Intergenic
900099492 1:955364-955386 GTCACATGGCTGCACAGCCCCGG + Intronic
900642808 1:3695437-3695459 GGCCCAAGGGTGCACAGCCCAGG - Intronic
900852266 1:5153465-5153487 GTCCAAAGACTGCACAGAGCAGG - Intergenic
901393672 1:8964748-8964770 GCCCCAATGCTCCACGGAGCCGG + Intronic
903452689 1:23465344-23465366 GTAATGAGGCTGCACAGAGCAGG - Intronic
904290420 1:29481881-29481903 CTCCCATGGCTACACAGAACAGG + Intergenic
905464219 1:38140508-38140530 GTCCCAAACATGCACAGGGCTGG + Intergenic
906033247 1:42736279-42736301 AGCCCAAGGTTGCTCAGAGCAGG - Intronic
906127273 1:43434637-43434659 CTCCCAAGGCTGTAGGGAGCTGG - Intronic
906648227 1:47491486-47491508 GTCCCAGGGCTGCAGACAGCTGG - Intergenic
906833484 1:49059205-49059227 GTCCCAAGGCTGCACAGAGCAGG - Intronic
906894655 1:49758025-49758047 GTCCTGAGGCTGTACAGAGCTGG - Intronic
906938433 1:50234930-50234952 GTCCTGAGGCTGCACAAAGCAGG - Intergenic
907584924 1:55608525-55608547 ATCCCAGGGCTGCACATAGGAGG + Intergenic
907749216 1:57246270-57246292 GTCCCAAGGCTGCACAGAGCAGG - Intronic
907862963 1:58371702-58371724 GTCCTGAGGCTTCACAGAGCAGG - Intronic
908006892 1:59736967-59736989 GTCTTGAGGCTGCACACAGCAGG - Intronic
908090992 1:60685686-60685708 GTCCCTAGGCTGCACACAGCAGG - Intergenic
908407774 1:63831559-63831581 GTCCTGAGGCTGCACAGAACAGG + Intronic
908715714 1:67067609-67067631 ATCCCAAGGCTGTACACAGTAGG - Intergenic
908933024 1:69340254-69340276 GTCCCGAGACTGCACAAAGCAGG - Intergenic
908963544 1:69730095-69730117 GTCCTGAAGCTGCACACAGCAGG + Intronic
909086245 1:71172760-71172782 GTCCTGAGGTTGCACAAAGCAGG + Intergenic
909228717 1:73058965-73058987 GTCCCAAGTCTTCACACAGCAGG + Intergenic
909235959 1:73152876-73152898 TCCCCGAGGCTGCAGAGAGCAGG + Intergenic
909250211 1:73344135-73344157 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909265946 1:73558449-73558471 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909269202 1:73601141-73601163 GTCCTGAGGCTACACACAGCAGG + Intergenic
909298704 1:73983684-73983706 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
909416847 1:75416202-75416224 GTCCCTAGGCTGCACACAGTAGG - Intronic
909574531 1:77159093-77159115 GTCCCTAGACTGCACAGTGCAGG - Intronic
909719783 1:78754547-78754569 GCCCCTAGACTGCACAGAGCAGG - Intergenic
909808838 1:79905920-79905942 GTCCCTAGGCTGCCCACAGCAGG + Intergenic
910064885 1:83141164-83141186 GTTGCTAGGCTGCACACAGCAGG - Intergenic
910141539 1:84031914-84031936 GTCCTGAGGCTGCATAGGGCAGG + Intergenic
910750465 1:90623781-90623803 CTCTCAAGGCTGCACAGGGTGGG + Intergenic
911011771 1:93288378-93288400 GCCTCTAGGCTGCACAGAGCAGG - Intergenic
911267703 1:95762475-95762497 GACCCTAGGCTGCACAGAGCAGG + Intergenic
911376356 1:97056606-97056628 GTCCCAAGGCTGCACACTGCAGG - Intergenic
911695898 1:100890281-100890303 GTCCCAAGGCTGCACAGAGTAGG + Intronic
911780323 1:101868773-101868795 GTCCCAAGGCTGCATACAGAAGG - Intronic
911790901 1:102014343-102014365 GTCCTTAGGCTGCACATAACAGG - Intergenic
911941444 1:104052544-104052566 GACACAAGGCTGCACAGAGCAGG + Intergenic
912043032 1:105416534-105416556 GTTCCTAGGCTACACAGAGCAGG - Intergenic
912052088 1:105542071-105542093 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
912206038 1:107510573-107510595 GTCCCTAGGCTGCACACAGCAGG - Intergenic
912520266 1:110240291-110240313 GACCCCAGGCTGCCCGGAGCAGG + Intronic
912579170 1:110704742-110704764 GTCCCTAGGCTGCACACAGGTGG + Intergenic
913018525 1:114763939-114763961 ATCCCAAGGCTGCACAGAGCAGG - Intergenic
913307759 1:117450641-117450663 GTCCCTAGGCTGCACACAAGGGG - Intronic
913668412 1:121071458-121071480 GTTCCTAGGCTGTACACAGCAGG + Intergenic
913710021 1:121473380-121473402 GTTCCCAGGCTGCACAGAGAAGG + Intergenic
914020155 1:143858901-143858923 GTTCCTAGGCTGTACACAGCAGG + Intergenic
914194338 1:145437567-145437589 TTTCCAAGGCTGCACAGCTCGGG + Intergenic
914351648 1:146845103-146845125 ATCCTTAGGCTGCACACAGCAGG + Intergenic
914475663 1:148020443-148020465 TTTCCAAGGCTGCACAGCTCGGG + Intergenic
914658656 1:149766813-149766835 GTTCCTAGGCTGTACACAGCAGG + Intergenic
915665464 1:157440278-157440300 ATTCCAAGGCTGCGCAGAGCAGG + Intergenic
915722864 1:157996700-157996722 GTCCCACTTCTGCCCAGAGCAGG + Intronic
915828291 1:159102099-159102121 TTCCGAAGGCTGCATAGAGCAGG - Intronic
916688865 1:167172093-167172115 GTCCCTAGACTGCACACAGTAGG - Intergenic
916736023 1:167607756-167607778 GTCCCCAGGCTGCAAAGGGCAGG - Intergenic
916987501 1:170207465-170207487 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
916993008 1:170265391-170265413 GTCCCCAGGCTGCATATAGCAGG + Intergenic
917140160 1:171827394-171827416 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
917152165 1:171956963-171956985 GTCCCTAGGCTGCACAGAGCAGG + Intronic
917245533 1:172996792-172996814 GTTCCTAGGCTGCACACAGCAGG - Intergenic
917261421 1:173173767-173173789 GTCCCGAGGTTGCATAGAGCAGG + Intergenic
917760987 1:178157525-178157547 TTCCCAAGGCTGCAGGGAGTTGG + Intronic
918166020 1:181948591-181948613 ATCCAAAGGCTGCATAGAGCAGG - Intergenic
918531187 1:185524260-185524282 GTACCTAGGCTGCACAGAGCAGG + Intergenic
918591529 1:186246096-186246118 GTCCTGAGGCTGCACACAGCAGG + Intergenic
918920096 1:190698223-190698245 GTCCCTAGGCTGCACATAGCAGG - Intergenic
919277506 1:195439877-195439899 GTCCCAAGGATGCATACAGCAGG + Intergenic
919291955 1:195643853-195643875 GTCTCTAGGTTGCACACAGCAGG + Intergenic
919917747 1:202149304-202149326 GACCCAAGGCTTCAGAGATCTGG - Intronic
919921244 1:202167840-202167862 TTGCCAAGGCTGGAGAGAGCGGG + Intergenic
920185455 1:204156513-204156535 TTCCCCAGCCTGGACAGAGCAGG + Intronic
920324951 1:205155890-205155912 GTTCGAAGGCTGCATACAGCAGG - Intronic
920650087 1:207831188-207831210 GCCCAAGGGCTGCACAGAGAGGG + Intergenic
920800496 1:209183149-209183171 GTCCCAAGGCTGCACACATCAGG - Intergenic
921318495 1:213914837-213914859 CTCCTAAGGCTGCACAGAGGAGG + Intergenic
921531233 1:216285242-216285264 GTCCCTAGACTGCACACAGTGGG - Intronic
921594396 1:217038611-217038633 GTCCCTAGGCTGCATAGAGCAGG + Intronic
921724336 1:218507565-218507587 GTCACAAGGCTGCATACAGCAGG - Intergenic
922667808 1:227487766-227487788 GTCCCAAGGCTGCACACTGCAGG + Intergenic
922900751 1:229134772-229134794 GTCCCTAGGTTGCACACAGCAGG - Intergenic
922918847 1:229283513-229283535 GTCCCATGGCTACAGAGAGCAGG + Intronic
923088720 1:230722078-230722100 GTCCAGAGGCTGCACAGAGCAGG - Intergenic
923932808 1:238721959-238721981 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
923996956 1:239506323-239506345 GTCCCTAGGCTGCACAGAGCAGG - Intronic
924040490 1:239979695-239979717 GTCCCTAGGCTGCACACAACAGG - Intergenic
924394735 1:243606836-243606858 GTCCCAAGGCTGCACAGAGCCGG - Intronic
924613026 1:245589410-245589432 GTCCCCAGGCGGCACTGAGAAGG + Intronic
924648682 1:245903815-245903837 GTCCCGAGGCTGCACACTGCAGG + Intronic
1062859221 10:797067-797089 GTCCCTAGGCTGTACACAGCAGG - Intergenic
1062911921 10:1217007-1217029 GTCCCAGGTCTGCACTGCGCTGG + Exonic
1063179935 10:3588991-3589013 CTCCCAGGGCTGCACAGAAAGGG - Intergenic
1063552103 10:7043138-7043160 GTGCCAAGCAAGCACAGAGCTGG + Intergenic
1063808955 10:9681515-9681537 GTCCCCAGGCTGTACGGAGCAGG - Intergenic
1064021555 10:11813323-11813345 GTTCCCAGGCCACACAGAGCTGG - Intergenic
1064360252 10:14657878-14657900 CTGCCAAGGCTGCAGTGAGCTGG - Intronic
1065159927 10:22909002-22909024 GTCCCTAGGCTGCATGCAGCAGG + Intergenic
1065408109 10:25390936-25390958 GTCCTAAGACTGCACAAAGCAGG - Intronic
1066154248 10:32657575-32657597 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1067058134 10:43064294-43064316 TTGCCCAGGCTGCTCAGAGCAGG + Intergenic
1067211183 10:44261370-44261392 GACCCCAGGCTGCAGTGAGCAGG + Intergenic
1067509046 10:46879859-46879881 GCACCAAGGATGAACAGAGCTGG - Intergenic
1067653205 10:48171991-48172013 GCACCAAGGATGAACAGAGCTGG + Intronic
1067708331 10:48627607-48627629 GACACAGGGCTGCACAGGGCAGG + Intronic
1067812330 10:49439434-49439456 GTCCGTAGGCTGCACACAGCTGG + Intergenic
1068235469 10:54227439-54227461 GTCCCAAGGCTGCACAAGCATGG + Intronic
1068454597 10:57238432-57238454 GTCCCAAGGCTACATAGAGTAGG - Intergenic
1068519500 10:58063002-58063024 GTCCCTAGGGTGCACACAGTAGG + Intergenic
1068805801 10:61192727-61192749 CTCCAGAGGCTGCACACAGCAGG + Intergenic
1069077393 10:64052395-64052417 ATCCCAAGGCTGCACAGAACAGG + Intergenic
1069339851 10:67397753-67397775 GTCCCAAGTCTGCATACAGCAGG - Intronic
1069424477 10:68277776-68277798 GTCCCTAGGTTGCACACAGCAGG - Intergenic
1069855960 10:71441172-71441194 GGCCCAAGGCTGTACAAAGCAGG + Intronic
1070191013 10:74112155-74112177 GTGTCAAGGCTGCACATGGCCGG - Intronic
1070365449 10:75732590-75732612 GGGCCAGGGCTGCACAGAGAAGG - Intronic
1070831826 10:79422446-79422468 GTCCGAGGGCTGCAGAGACCTGG + Intronic
1071035501 10:81239283-81239305 GTCCTAAGGGTGGACAGAGCAGG + Intergenic
1071098941 10:82012304-82012326 GTCCCTAGGCTACAAAGAGCAGG + Intronic
1071244882 10:83751766-83751788 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1071245065 10:83753006-83753028 GTCCTAAAGCTGCACAGAGCAGG + Intergenic
1071482191 10:86073312-86073334 GTCCCCCTGCTGCACAGAGCTGG - Intronic
1071818315 10:89254451-89254473 GTCCCTAGGCTGCACACAGCAGG + Intronic
1071873473 10:89819161-89819183 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1071990599 10:91097464-91097486 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1072019314 10:91382674-91382696 GGCCCCAAACTGCACAGAGCAGG + Intergenic
1072620614 10:97076674-97076696 GGCCCAAGGCAGCACAATGCAGG - Intronic
1073625913 10:105096619-105096641 GACCGAAGGCTGCACAGAAGAGG + Intronic
1073627967 10:105119102-105119124 GTTTCCAGGCTGCACACAGCAGG - Intronic
1073880275 10:107973171-107973193 TTCCTAAGCCTGCACACAGCAGG - Intergenic
1073929230 10:108555311-108555333 GTCCTGAGGCTGCATAGAGTAGG - Intergenic
1073942367 10:108713404-108713426 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1073964878 10:108977794-108977816 GTCCCTAAGCTGCACTCAGCAGG - Intergenic
1074069119 10:110049014-110049036 GTCCCTAGGTTGCACACAGCAGG - Intronic
1074622373 10:115138634-115138656 GTCCCTAGGCTGTACAGAGCAGG + Intronic
1075102058 10:119513388-119513410 AGGCCAAGGCTGCACTGAGCCGG + Intronic
1075281687 10:121144141-121144163 GTCCCTAGGTTGCACAGAGCAGG + Intergenic
1075530577 10:123225585-123225607 GTCCCTAGGCTGCACACAACAGG + Intergenic
1075543700 10:123337472-123337494 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1075713404 10:124542654-124542676 GGCCCCAGGGTGCACAGGGCTGG - Intronic
1076294597 10:129374742-129374764 GCCCCAAAGCAGCACGGAGCGGG - Intergenic
1076532143 10:131152003-131152025 GTTTCAAGGCTGCACAGAGCAGG + Intronic
1076731630 10:132442317-132442339 TTCCAAATGCAGCACAGAGCAGG + Intergenic
1076881431 10:133241349-133241371 GTCCCGAGGCTGCTGCGAGCAGG - Exonic
1077123402 11:921518-921540 GGCCCAAGGGTGCCCTGAGCCGG + Intergenic
1077365332 11:2159269-2159291 GTCCCGGGGCTGCCCAGAGCTGG + Intronic
1077368393 11:2170511-2170533 GTCCCAGGCCTGGACAGAGGGGG + Intronic
1077444608 11:2585145-2585167 GTCCTGAGGCTGCACCCAGCTGG + Intronic
1077979588 11:7286383-7286405 GTCCTGAGGCTGCACACAGCAGG + Intronic
1078308955 11:10219367-10219389 GTCCCTAGACTGCACACAGCAGG + Intronic
1078959547 11:16248656-16248678 ATCCCAAAGCTACACAGTGCAGG + Intronic
1079147633 11:17867924-17867946 GTCCCTAGGCTGCATACAGTAGG + Intronic
1079239461 11:18712359-18712381 GTCCAAAGCCTCCACAGGGCCGG - Exonic
1079445906 11:20555941-20555963 GTCCTCAGGCTGTACACAGCAGG + Intergenic
1079542607 11:21594030-21594052 ATCCAAAGGTTGCACACAGCAGG - Intergenic
1079586204 11:22128935-22128957 GTCCCTAGGCTTCACAGAGCAGG + Intergenic
1079707407 11:23637854-23637876 GTTCCAAGGCTGCATAGAGAAGG + Intergenic
1079716707 11:23756726-23756748 GTCCCAAGGCAGCACACAGCGGG - Intergenic
1079744384 11:24106760-24106782 GTCCCAAGGCTTCACAGAGCAGG - Intergenic
1079785310 11:24664605-24664627 GTCCAGAGGCTGCGCAGAGCAGG - Intronic
1079804291 11:24910455-24910477 GTCCAGAGGCTGTACAGAGCAGG - Intronic
1079838685 11:25367034-25367056 GTCTCTATGCTGCACACAGCAGG + Intergenic
1079916170 11:26371138-26371160 GTCCTGAGACTGCACAGAGCTGG - Intronic
1079945176 11:26732887-26732909 GTCCTTAGGCTGCACAGAGCAGG - Intergenic
1080088496 11:28315730-28315752 GTCCCTAGGCTGCACAGAACAGG - Intronic
1080359366 11:31494407-31494429 GCCCCAGGACTGCACAGAACAGG + Intronic
1080600645 11:33818525-33818547 ATCCCCAGGCAGCACTGAGCTGG + Intergenic
1080643905 11:34174490-34174512 GTCCCCTGGTGGCACAGAGCGGG - Intronic
1080683739 11:34498645-34498667 ATCCCCAGGGTGCACAGAGCAGG + Intronic
1080715649 11:34797488-34797510 GTCCCTAGGCAGCACACAGCAGG - Intergenic
1081167125 11:39820324-39820346 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1082255252 11:50027102-50027124 GTTCTGAGGCTGCACACAGCAGG - Intergenic
1082734297 11:56839064-56839086 GTCCCGAGGCTGCATAGAGTAGG + Intergenic
1082766213 11:57169881-57169903 GTCCCTAGGCTGCACAGCACAGG + Intergenic
1082948021 11:58780717-58780739 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1083500783 11:63105631-63105653 GCCCCTAGGATGCACACAGCAGG + Intronic
1083656040 11:64230275-64230297 GTCACAAAGCCGCAGAGAGCGGG + Exonic
1083944339 11:65915745-65915767 TTCCCAAGGCTGGGCAGAGGGGG + Intergenic
1084498706 11:69521535-69521557 GTCCTGAGGCTGCACAGGGCAGG + Intergenic
1085875725 11:80404482-80404504 GTCCCAAAGCTGCATAGAGCAGG - Intergenic
1086006735 11:82047127-82047149 GTATCTAGGCTGCACACAGCAGG - Intergenic
1086084916 11:82944358-82944380 GTTCCTAGGCTGCACACAGCAGG + Intronic
1086454254 11:86945970-86945992 GCCCGACTGCTGCACAGAGCAGG + Exonic
1086503637 11:87479400-87479422 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1086769520 11:90744848-90744870 GTCCCTAGGTTGTACACAGCAGG - Intergenic
1086936129 11:92747395-92747417 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1087731083 11:101779396-101779418 GTTCCTAGGCTGCACACAGTAGG - Intronic
1087793618 11:102432782-102432804 GTCCCCAGGCTGCATAGAGCAGG - Intronic
1087908308 11:103724714-103724736 ATCCTGAGGCTGCACAGAGCAGG + Intergenic
1088447734 11:109950215-109950237 GTCCAGAGGCTCCACACAGCAGG + Intergenic
1089294254 11:117458503-117458525 GACTCAATGCTGCAGAGAGCAGG + Intronic
1090179640 11:124685196-124685218 GTCCCGAGGCTGCATACAGCAGG - Intronic
1090504612 11:127297970-127297992 TTCCCTAGGCTGCACACAGCAGG - Intergenic
1090692557 11:129199416-129199438 GTCCCTAGGCTGCACACAGCAGG - Intronic
1091086364 11:132725370-132725392 GTCCTTAGGATGCACACAGCAGG + Intronic
1091221888 11:133934686-133934708 GTCCGACTGCTGCCCAGAGCTGG - Intronic
1091350689 11:134891827-134891849 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1092618210 12:10234705-10234727 TTCCCAAGGGTGCACAGAGCAGG + Intergenic
1092643066 12:10537899-10537921 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1092665469 12:10791887-10791909 GTCCCTAGGCTGCACACAACAGG + Intergenic
1093192605 12:16092154-16092176 GTCCTGAAGTTGCACAGAGCAGG + Intergenic
1093353086 12:18128067-18128089 GTCCCTGGGATGCACACAGCAGG - Intronic
1093629133 12:21387412-21387434 GTTCCAAGGGTGTACACAGCAGG - Intronic
1094282495 12:28755170-28755192 GTCCTTGGGCTGCACACAGCAGG + Intergenic
1094397637 12:30025142-30025164 ATCACAAGGCTGCAAAGAGCAGG + Intergenic
1094421189 12:30272932-30272954 GTCCTGAGGCTACATAGAGCAGG + Intergenic
1094780844 12:33790087-33790109 GTCCCAAACCTGCACACAGCAGG + Intergenic
1094786918 12:33859408-33859430 GTCCCTAGACAGCACACAGCAGG + Intergenic
1094798503 12:34002654-34002676 GTCCCTAGACTTCAGAGAGCAGG + Intergenic
1095214015 12:39527120-39527142 GTGGCTAGGCTGCACATAGCAGG + Intergenic
1095345904 12:41148392-41148414 ATCCCTAGGCTGCACAGAGCAGG + Intergenic
1095640900 12:44483764-44483786 GTTCTGAGGCTGCACACAGCAGG + Intergenic
1095689301 12:45069295-45069317 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1095836831 12:46648335-46648357 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1096566066 12:52480300-52480322 GTTCCAAGGCAGCATAGAGAAGG - Intergenic
1096955945 12:55526299-55526321 GTCAGAAGTCTGGACAGAGCAGG + Intergenic
1097368085 12:58742217-58742239 GTCCCAAGGCTGCACAGAGCAGG - Intronic
1097404855 12:59177080-59177102 GTCCCTAGGATGAACACAGCAGG + Intergenic
1097443952 12:59646291-59646313 GTCTTGAGGCTGCACACAGCAGG - Intronic
1097445611 12:59667858-59667880 GTCCCTAGGCTGTACACAGCAGG - Intronic
1097599256 12:61671063-61671085 GTCTTGAGGCTGCACAGAGCAGG + Intergenic
1097654717 12:62344903-62344925 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1097735782 12:63179454-63179476 GTCCCCTGGCTGCACATAGCAGG - Intergenic
1097757997 12:63427784-63427806 GTCCTGAGGCTGCATAGCGCAGG + Intergenic
1098327379 12:69316586-69316608 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1098686939 12:73434057-73434079 GTCCCTAGGCTACACAGAGCAGG - Intergenic
1098713652 12:73801236-73801258 GTCCTGAGGCTGCATAGAACAGG - Intergenic
1098746565 12:74245022-74245044 CTCCCTAGGCTACCCAGAGCAGG + Intergenic
1099088609 12:78278181-78278203 GTCCTAAGGCTGCACATAGCAGG - Intergenic
1099371338 12:81834973-81834995 TTCCCTGGGCTGCATAGAGCAGG - Intergenic
1099390186 12:82070083-82070105 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1099407432 12:82281536-82281558 GTCCCAAGGCTACACATAGCAGG - Intronic
1099490743 12:83284893-83284915 GTCCCTAGACTGCAGACAGCAGG - Intergenic
1099492769 12:83307109-83307131 GTCGCCAGGCTGCACACAGCAGG - Intergenic
1099607902 12:84828675-84828697 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1099621253 12:85005314-85005336 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1099769183 12:87030089-87030111 GTCACTAGGGTGCACACAGCTGG + Intergenic
1099838455 12:87937109-87937131 GTCCTGAGGCTGCGCAAAGCAGG - Intergenic
1099899978 12:88695690-88695712 GTCCCAAGGTTGCCTACAGCAGG + Intergenic
1099905165 12:88762258-88762280 GTCTTGAGGCTGCATAGAGCAGG + Intergenic
1099996666 12:89786389-89786411 GTTCTGAGCCTGCACAGAGCAGG - Intergenic
1100032362 12:90208987-90209009 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1100674915 12:96856152-96856174 GTCCCTAGGCTGCACACAGGAGG + Intronic
1100747516 12:97661921-97661943 AGTCCAAGGCTGCACACAGCAGG + Intergenic
1100929148 12:99585844-99585866 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1100937935 12:99691161-99691183 GTTCCAAGGCTGCACAGAGCAGG + Intronic
1101033861 12:100685749-100685771 GTCCCGAGGCTGCACAGAACAGG + Intergenic
1101083740 12:101214593-101214615 GTCCCTAGGCTAGACACAGCAGG - Intergenic
1101194669 12:102370075-102370097 GTCCCAAGGCTGCACAGAGGAGG + Intergenic
1102016639 12:109652383-109652405 AGCCCAAGGCTGCACAGGGATGG - Intergenic
1102180479 12:110908988-110909010 GTCCCCTGGCTGCAGAGACCTGG - Intergenic
1102182118 12:110920578-110920600 GTTCCTGGGCTGCAGAGAGCTGG - Intronic
1102528638 12:113530190-113530212 GTCCATAGGCTGCACACAGCAGG - Intergenic
1102826233 12:115949987-115950009 CTCCCAAGGCAACACAGTGCGGG - Intergenic
1103264556 12:119618030-119618052 GTCCAGAGGCTGCACACAGCAGG - Intronic
1104079874 12:125420494-125420516 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1104090749 12:125514961-125514983 GTCCCAGGGCTCCAGAGAGGAGG + Intronic
1104172126 12:126292144-126292166 GTTGCTAGGCTGCACACAGCAGG + Intergenic
1104587928 12:130062513-130062535 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1104653638 12:130556872-130556894 GCCCTAAGGGTGCACAGTGCTGG - Intronic
1104725970 12:131075950-131075972 GACCCAGGGCTGCTCAGAGGTGG - Intronic
1104808082 12:131602164-131602186 GTCCTGAGGCTGCGCACAGCAGG + Intergenic
1105257214 13:18751728-18751750 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1105257700 13:18755256-18755278 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1105259875 13:18771090-18771112 GTCCTGAGGCTGCACACAGAAGG + Intergenic
1105262555 13:18790413-18790435 GTCCTGAGGCTGCACACAGAAGG + Intergenic
1105694103 13:22871441-22871463 GTCTAAAGGCTGCACACAGCAGG - Intergenic
1105770829 13:23610443-23610465 GTCCCAAGGGAGCAGAGGGCTGG - Intronic
1105886761 13:24649241-24649263 GTCCCAAGGCTTCGCATAACTGG + Intergenic
1106572170 13:30936684-30936706 GTCCCAGTGCTCCACAGGGCTGG + Intronic
1106718750 13:32418203-32418225 GTTTCAAGGCTGCACACAGCAGG - Intronic
1106864407 13:33948165-33948187 GTCCCAAGGCTGCATGGAGCAGG - Intronic
1108219234 13:48216439-48216461 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1108796208 13:54033617-54033639 GTCCCTAGACTGCACACAGCAGG + Intergenic
1108828947 13:54452898-54452920 GTCCTGAGGCTGCATAGGGCAGG + Intergenic
1108885649 13:55178276-55178298 GTCCCGAGGCTGCACAGAGCAGG - Intergenic
1109109034 13:58292651-58292673 GTCCTTACGCTGCACACAGCAGG - Intergenic
1109300747 13:60587484-60587506 GTGCCAAGACGGCACTGAGCTGG + Intergenic
1109324679 13:60853026-60853048 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1109334082 13:60970945-60970967 GTCCCGAGACTGCACACAGCAGG - Intergenic
1109407347 13:61919014-61919036 GTCCTTAGGCTGCACACAGCAGG + Intergenic
1109655719 13:65387969-65387991 GTCCTTAGGCTGCACACAGCAGG - Intergenic
1110028243 13:70570655-70570677 GTCCTTAGGCTGCACAGAGCAGG - Intergenic
1110044314 13:70809840-70809862 GTCTCTAGGCTGCACAGAGCAGG - Intergenic
1110048420 13:70860693-70860715 GTCTCTAGACAGCACAGAGCTGG + Intergenic
1110208657 13:72947329-72947351 GTCCCGAAGCTGCATAGAGCAGG + Intronic
1110359637 13:74610626-74610648 GTCCCAAGGCTGCACCCAGCAGG - Intergenic
1110496536 13:76174373-76174395 GTCTGGAGGCTGCACAGAGTAGG + Intergenic
1110955360 13:81546727-81546749 TTCCTGAGGCTGTACAGAGCAGG + Intergenic
1111064468 13:83072596-83072618 ATCTTGAGGCTGCACAGAGCAGG - Intergenic
1111307501 13:86434435-86434457 GTCACTAGGCTGCACACAGCTGG - Intergenic
1111339247 13:86862421-86862443 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1111343084 13:86913841-86913863 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
1111441302 13:88285566-88285588 GTCCTGAGGCTGCACACAGAAGG - Intergenic
1111441425 13:88286308-88286330 GTCCCGAGGCTGCACAGAGCAGG + Intergenic
1111457691 13:88506353-88506375 GTCCTAAGGCTGCACATGGCAGG - Intergenic
1111472080 13:88695962-88695984 GTCCCTAGGGTGAACATAGCAGG + Intergenic
1111505492 13:89183915-89183937 GTCCTAAGGCTGCACAGAACAGG + Intergenic
1111606680 13:90547699-90547721 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1111716681 13:91887298-91887320 GTCTCTAGGCTGCACACAGCAGG + Intronic
1111751367 13:92335362-92335384 GTCCCAAGGCTGAATACAGAAGG + Intronic
1111799102 13:92960362-92960384 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1112308668 13:98298351-98298373 GTCCCATGCTTGCACAGAGGTGG + Intronic
1112769674 13:102781810-102781832 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1112789559 13:102988045-102988067 TTCCCAAAGCTGCACAGAGCAGG + Intergenic
1112857230 13:103786683-103786705 GTCCCTAGGCTGCACACAACAGG + Intergenic
1112971671 13:105270059-105270081 GTCCCTAGGCTGCACATGGCAGG - Intergenic
1113645268 13:111990579-111990601 GTCCCAACGCTGCATACTGCAGG - Intergenic
1114147474 14:19994063-19994085 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1114986714 14:28238791-28238813 GTCCCTAGTCTGCACAGAGCAGG - Intergenic
1114989781 14:28272516-28272538 GTCCCTAGGCTGTACAGAACAGG + Intergenic
1115010570 14:28540207-28540229 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1115085809 14:29513432-29513454 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1115090420 14:29567683-29567705 GTCCCAAGGTTGCACAGAGTAGG + Intergenic
1115132662 14:30072678-30072700 GTCCCTAGGTTGCACACAGCAGG - Intronic
1115609084 14:35034644-35034666 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1115878755 14:37891731-37891753 GTTCCTAGGCTGCACACAGCAGG - Intronic
1115943044 14:38629555-38629577 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1116080225 14:40162349-40162371 GTCACTAGGCTGCACATAGCAGG - Intergenic
1116095278 14:40359553-40359575 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1116098932 14:40408582-40408604 GTCCTGAGGCTTCACAGAGCAGG + Intergenic
1116126606 14:40796599-40796621 GTCCCTTGGCTGCACAAAGCAGG + Intergenic
1116138665 14:40959778-40959800 GTCCCTAGGCTGCATACAGCAGG + Intergenic
1116265745 14:42687550-42687572 GTCCCTAGACTGCACACGGCAGG + Intergenic
1116296687 14:43119850-43119872 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1116356473 14:43937148-43937170 GTCCCTAGGCTGGACACAGCAGG + Intergenic
1116389650 14:44377182-44377204 GTCCCTAGGCTGTACACAGCAGG + Intergenic
1116533872 14:46006992-46007014 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1116625118 14:47254053-47254075 GTCCTGAGGCTGCATAGAGCAGG + Intronic
1117084138 14:52181491-52181513 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1117203661 14:53418397-53418419 GTTCTAAGGCTGCACTCAGCAGG - Intergenic
1117427939 14:55620690-55620712 GTCCCTAGGCTACATACAGCAGG + Intronic
1117632708 14:57710126-57710148 GTCTTGAGACTGCACAGAGCAGG - Intronic
1117907479 14:60605558-60605580 GTCTTGAGGCTGCACAGAGCAGG - Intergenic
1117908257 14:60612198-60612220 GTCTTGAGGCTGCACAGAGCAGG + Intergenic
1118037418 14:61883052-61883074 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1118456300 14:65948225-65948247 GTGCTAAGGGTGCACATAGCAGG + Intergenic
1119142933 14:72284368-72284390 GTCCCTAAGCTGCACATAGCAGG - Intronic
1119305816 14:73607397-73607419 GTCACAAGGCTGCACACAGCAGG + Intergenic
1119450170 14:74702486-74702508 GTCCCTACACTGCACACAGCAGG + Intronic
1119678251 14:76572572-76572594 TTCCCAAGGCTCAAGAGAGCTGG + Intergenic
1120378021 14:83733940-83733962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1120485907 14:85112959-85112981 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1120570929 14:86116095-86116117 GTCCTGAGGCTGCACAGGCCTGG - Intergenic
1120590932 14:86372619-86372641 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1120592405 14:86391240-86391262 GCCACAAACCTGCACAGAGCTGG + Intergenic
1120654186 14:87169482-87169504 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1120659058 14:87230885-87230907 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1120738303 14:88079526-88079548 GCCCCAAAGCTGAAGAGAGCAGG - Intergenic
1120921094 14:89756000-89756022 GTCTCAAGGCTGCACAGAGCAGG + Intergenic
1120971943 14:90214921-90214943 GTCCCAAAGCTGTACACAGCAGG + Intergenic
1121166487 14:91806942-91806964 GTCCCTAGGCTGCACACAACAGG - Intronic
1121495534 14:94389404-94389426 CCCCCCAGGCTGCTCAGAGCAGG + Intronic
1121563574 14:94892536-94892558 GTCTCCAGGCTGCACTGTGCGGG - Intergenic
1121820127 14:96959346-96959368 GTCCCAAGGCTGTCCACAGTAGG + Intergenic
1121822646 14:96983880-96983902 CTCCCAAGTCAGCACTGAGCTGG + Intergenic
1122860580 14:104580697-104580719 GTCCCATGGCCACACAGGGCAGG - Intronic
1123737593 15:23200327-23200349 GTCTCAAGGCTGCACACAGCAGG + Intergenic
1124062346 15:26306033-26306055 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1124226205 15:27897288-27897310 GTCCCTGGGCTACACAGGGCAGG - Intronic
1124226228 15:27897378-27897400 GTCCCTGGGCTGCACAGAGCAGG - Intronic
1124288804 15:28428989-28429011 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1124294420 15:28488324-28488346 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1125454196 15:39841036-39841058 GACCCAGGGCAGCAGAGAGCTGG - Intronic
1126190573 15:45873838-45873860 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1126256053 15:46627159-46627181 TTCCTAAGGCTGCATAGAACTGG - Intergenic
1126276953 15:46894948-46894970 GTACCAAGAGTGCACCGAGCTGG - Intergenic
1126399850 15:48257684-48257706 GTCCCTAGGCTGCACACAGCAGG + Intronic
1126514980 15:49524253-49524275 GTCCCTAGGCTGCACAGAGCAGG - Intronic
1126533283 15:49733416-49733438 GTCCTTAGGCTGCACACATCAGG + Intergenic
1126825093 15:52540583-52540605 GTCCAGAGGCTGCACACAGCAGG + Intergenic
1126920748 15:53521031-53521053 GTCCCTGAACTGCACAGAGCTGG + Intronic
1126942474 15:53781383-53781405 ATCCCAAGGCTGCACACAGCAGG + Intergenic
1127164709 15:56232376-56232398 GTCTCTAGGTTGCAAAGAGCAGG + Intronic
1127186452 15:56485647-56485669 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1127791053 15:62398988-62399010 GTCCCAAGGCTGCACACAGCAGG - Intronic
1128326154 15:66725580-66725602 GTGCCAGTGCTGGACAGAGCAGG + Intronic
1128578616 15:68793058-68793080 TGCCCCAGGATGCACAGAGCTGG - Intronic
1129440581 15:75578616-75578638 GCCCCGTGGCTGCAAAGAGCCGG + Intronic
1129549193 15:76429966-76429988 GTCCCTAGACTGCACAGAGCAGG - Intronic
1129851978 15:78798661-78798683 GGCCCAGGGCTGCCCAGAGAAGG + Intronic
1129900498 15:79144452-79144474 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1130251021 15:82300426-82300448 GGCCCAGGGCTGCCCAGAGAAGG - Intergenic
1130409358 15:83631681-83631703 GGCCTGAGGCTGCATAGAGCCGG + Intergenic
1130422062 15:83757467-83757489 GTCCCTAGGCTGCACACAGCAGG + Intronic
1130791434 15:87160168-87160190 GTCCCTAGGCTGCATACAGCAGG - Intergenic
1131723795 15:95201337-95201359 GTCCTGAGTCTGCATAGAGCAGG - Intergenic
1131921415 15:97332714-97332736 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1132121953 15:99183921-99183943 GTCCCTAGGCTGCACACAGCAGG - Intronic
1132785516 16:1655134-1655156 GTCCCGAGGCTGCTTACAGCAGG - Intronic
1133504612 16:6399183-6399205 GTCCCGAGGCAGCACAGAGCAGG + Intronic
1134416556 16:14048391-14048413 GTCCCAAGTCTTTGCAGAGCTGG - Intergenic
1134658203 16:15963712-15963734 GTCCTAAGGCTGCACACATCAGG + Intronic
1134660616 16:15981591-15981613 CTCCCTAGGCAGCACACAGCAGG + Intronic
1135919066 16:26631958-26631980 GTCCCTAGGCTGCACACAGCGGG + Intergenic
1135926049 16:26694975-26694997 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1136008626 16:27348023-27348045 GCCCCTGGGATGCACAGAGCCGG - Intronic
1136031489 16:27506444-27506466 GTCCCCAGGGGGCTCAGAGCTGG + Intronic
1136372052 16:29842660-29842682 GTTCCTAGGCTGCACCCAGCAGG - Intronic
1136372119 16:29843003-29843025 GTCCACAGGCTGCAAACAGCAGG - Intronic
1136709918 16:32228671-32228693 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1136757991 16:32700740-32700762 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1136810115 16:33169635-33169657 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1136816591 16:33279715-33279737 GTCTCTAGGCTGCACACAGCAGG - Intronic
1136872503 16:33820385-33820407 TTCCCAAAACTGCACAGAGCAGG + Intergenic
1137773318 16:51035866-51035888 ATCCCAGAGCTGCACAGATCAGG + Intergenic
1137951897 16:52791782-52791804 GTCCCAAGGCTGCATAGAGTAGG - Intergenic
1137993675 16:53185712-53185734 GTCCCAAGGCTGCACACAGCAGG - Intronic
1138798846 16:60001736-60001758 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1139691597 16:68645364-68645386 GCCCCATGGCTGCAGAGAGAGGG - Exonic
1139982386 16:70870432-70870454 ATCCTTAGGCTGCACACAGCAGG - Intronic
1140146929 16:72320136-72320158 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1140832676 16:78766005-78766027 GACCCAAGTCTGCACAGAAAAGG + Intronic
1141019891 16:80485303-80485325 CTCCCAAGGCAGCACAGAGCTGG + Intergenic
1141214179 16:82008923-82008945 GTCCCTAGGCTGCATAGAGCAGG - Intronic
1141273030 16:82558141-82558163 GTCCCAAGGCTACATAGAGCAGG - Intergenic
1141313106 16:82934373-82934395 GTCCTTAGGCTGCACACAGCTGG + Intronic
1141317802 16:82978485-82978507 GTTCCCATGCTGCACAAAGCAGG - Intronic
1142007833 16:87698364-87698386 GTCTGAGAGCTGCACAGAGCAGG - Intronic
1203060142 16_KI270728v1_random:961089-961111 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1203099669 16_KI270728v1_random:1295683-1295705 TTCCCAAAACTGCACAGAGCAGG - Intergenic
1142847608 17:2689866-2689888 GCCCCAAGGCTGCGCCCAGCTGG + Exonic
1143931966 17:10438499-10438521 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1143935743 17:10482224-10482246 GTCCTAAGGCTGCATAGAGCAGG + Intergenic
1144225229 17:13138802-13138824 GTCCCAAGGATGCATAGAGCAGG - Intergenic
1144285494 17:13770217-13770239 GTCCCTAGGCTTAACACAGCAGG + Intergenic
1144399686 17:14884067-14884089 ATCCCAAGGCAGCACAAAGCAGG + Intergenic
1144500158 17:15779262-15779284 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1144508745 17:15857061-15857083 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1145172864 17:20674701-20674723 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1145910701 17:28540463-28540485 GGCCCAGGGTTGGACAGAGCTGG - Intronic
1146451967 17:32981750-32981772 GTCCCGAGGCCGCACACAGCAGG + Intronic
1147348745 17:39823620-39823642 GTCCTGAGCCTGCACAGAACAGG - Intronic
1147834439 17:43319940-43319962 GTCCCCAGGCTGCACAGAGCAGG + Intergenic
1148108544 17:45132140-45132162 TTCCCCAGGCTGCACGGGGCTGG - Intronic
1148211870 17:45813524-45813546 CTCCTAAGGATGCACAGAGGGGG - Intronic
1148212580 17:45817366-45817388 GACCCAAGGGTGCACACAGGAGG - Intronic
1148390557 17:47269117-47269139 GTTCCTAGGCTGCACATAGCAGG + Intronic
1148471104 17:47894027-47894049 GTGCCAGGGCAGCACAGAGGAGG + Intergenic
1148801014 17:50225861-50225883 GTCCCTAGGCCGCACACAGCAGG + Intergenic
1149064641 17:52465592-52465614 GTCGCTAGGCTGCACACAGCAGG - Intergenic
1149112387 17:53048921-53048943 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149131337 17:53305374-53305396 GTCCCTAGACTGCACAGAGCAGG + Intergenic
1149143138 17:53458041-53458063 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1149339702 17:55672664-55672686 GTTCTGAGGCTGCACAGAGCAGG + Intergenic
1149371002 17:55993256-55993278 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149562572 17:57619287-57619309 GTCCCAAGGCTACCCAGGGCTGG - Intronic
1149902341 17:60492015-60492037 GTCCCTAGTCTGCACACAGCAGG - Intronic
1151501018 17:74488891-74488913 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1151950529 17:77351175-77351197 TTCCCAAGGCTGCACATGGAGGG + Intronic
1152815686 17:82406291-82406313 GCCCTGAGGCTGCACCGAGCCGG + Intronic
1153199307 18:2633060-2633082 GTCCCTAGACTGCACACTGCAGG - Intergenic
1153624586 18:7012015-7012037 GTCCCACCTCTGCTCAGAGCTGG - Exonic
1153817128 18:8800230-8800252 CTCACAGAGCTGCACAGAGCCGG + Intronic
1153846047 18:9050853-9050875 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1154011670 18:10579820-10579842 GCCCCAAAGCTGGAGAGAGCTGG - Intergenic
1154426146 18:14273711-14273733 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1154431159 18:14309640-14309662 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1154433835 18:14328945-14328967 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1154506607 18:15046305-15046327 GACCCTAGGCTGCACACAGCAGG + Intergenic
1155121660 18:22826929-22826951 GTGCCAAGGCTACCCAGAGGTGG - Intronic
1155544785 18:26903846-26903868 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1156061427 18:33081088-33081110 GTGCCCAGGCTGAACAGAGGAGG + Intronic
1156078396 18:33307711-33307733 ATCCCAAGGCTGCACAGAGCAGG - Intronic
1156169386 18:34463621-34463643 GTTCTAAGGCTGCACACAGAAGG + Intergenic
1156207923 18:34906234-34906256 GTCCCAAAGCTGCACACAGCAGG + Intergenic
1156243573 18:35276477-35276499 GTCCCTAGGCTGCACACAGCAGG - Intronic
1156607241 18:38680527-38680549 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1156769140 18:40698337-40698359 GTCCCTAGGCTACACACAGTTGG - Intergenic
1156784378 18:40892853-40892875 GTCCTGAGACTGCATAGAGCAGG - Intergenic
1156892325 18:42204689-42204711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1157750201 18:50171700-50171722 GTCACATGGCTGCATAGAGGAGG + Intronic
1157781607 18:50444693-50444715 ATCCCAAGGCTACATAGAGCAGG + Intergenic
1158020618 18:52837118-52837140 GTCCCTAGGCTGCACACAGCAGG + Intronic
1158166530 18:54547186-54547208 GTCCCAAAGCTGCATAGAGCAGG - Intergenic
1158196822 18:54896762-54896784 GTCCCAAGGTTGCTCAGAGTGGG - Intergenic
1158335777 18:56414088-56414110 GTCCCTAGGTTGCACACAGCAGG - Intergenic
1158822622 18:61178804-61178826 GTTTCTAGGCTGCACACAGCAGG - Intergenic
1159131121 18:64281363-64281385 GTCTTTAGGCTGCACAGAGCAGG - Intergenic
1159138176 18:64361442-64361464 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1159357737 18:67358710-67358732 GTCCCAAGGCTGCACAGAACAGG - Intergenic
1159461219 18:68724177-68724199 GTCCTGAGGCTACATAGAGCTGG + Intronic
1159555480 18:69940942-69940964 GTCCCGAGGCTGCATAGAGCAGG - Intronic
1159583792 18:70263468-70263490 GTCCCAAGGCTGTGCAGAGCAGG - Intergenic
1159606238 18:70478131-70478153 GTCCCAAGGCTGCACATAGCAGG - Intergenic
1159640614 18:70859377-70859399 GTCCGAAGGCTGCACAGAGCAGG - Intergenic
1159643187 18:70887655-70887677 GTCCCGAGGCTGCACAGAGCAGG - Intergenic
1159705399 18:71679727-71679749 GTCCTTAGGCTGCACAGAGTAGG - Intergenic
1159717944 18:71849118-71849140 GTCCTGAGGCTGCACAGAGTTGG - Intergenic
1159751072 18:72303126-72303148 GTCCCTAGGCTGCACACAGAAGG + Intergenic
1159756315 18:72370562-72370584 GTCCCAAGGCTGCACACAGCTGG - Intergenic
1159805862 18:72957682-72957704 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1159811783 18:73025648-73025670 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1159838785 18:73372528-73372550 GTCCCTAGGTTGCACACAACAGG - Intergenic
1159895960 18:73996372-73996394 GTCCCTAAGCTGCATACAGCAGG - Intergenic
1160186837 18:76682408-76682430 GTCCCAGCCCTGCACAGAGCTGG + Intergenic
1160627215 18:80218989-80219011 GTGCCAAGGCTGCAGACAGCAGG + Intronic
1160980396 19:1814006-1814028 GTCCCAAGGCTGGCCAGCCCTGG - Intergenic
1161508462 19:4657254-4657276 TGCCCCAGGCTGCAGAGAGCAGG + Intronic
1161938195 19:7385187-7385209 GAACCAAGACTGCACAGAGCAGG + Intronic
1162002715 19:7757588-7757610 GTCCCAAGGTTGCATAGAACAGG - Intergenic
1162909591 19:13842043-13842065 GACCCCAAGCTGCACAGGGCTGG + Intergenic
1163271336 19:16256058-16256080 GTCCCAAAGCAGGACTGAGCTGG + Intergenic
1163449272 19:17366072-17366094 GTGCTAAGGCTGCAGGGAGCCGG - Intronic
1164214090 19:23128886-23128908 GTCCCTAGGCTTCACAGAGCAGG - Intronic
1164851186 19:31485517-31485539 GTCCCTAGACTGCACACAGCAGG + Intergenic
1164879710 19:31721633-31721655 GTTCCAAGGCAGCTCAGTGCCGG + Intergenic
1164921785 19:32093811-32093833 GACCCGAGGCTGCAGAGAGGAGG + Intergenic
1165458149 19:35926931-35926953 GACCCAAGGCAGGAAAGAGCTGG + Intergenic
1166164975 19:40980977-40980999 GTCCCAAGGCTGCACATAGCAGG + Intergenic
1166252767 19:41582737-41582759 GTCTCTAGGCCGCACACAGCAGG + Intronic
1166965458 19:46527128-46527150 GTCCCCAGGCTGCCCAGCCCTGG + Intronic
1168559970 19:57374305-57374327 GTCCCGAGGCTGCATAGAGCAGG + Intronic
1168702409 19:58449062-58449084 GTCTGTAGGCTGCACACAGCAGG - Intergenic
924993621 2:337825-337847 GTCCCAAGGCTGCACACAAAAGG - Intergenic
925019933 2:560420-560442 GTCCCAAGGGAGTACAGAGAAGG - Intergenic
925245573 2:2379617-2379639 GTCCTAAGGCTGCAGAGAACAGG - Intergenic
925354385 2:3227733-3227755 GTCCCAAGGCTGCACAGAGCAGG - Intronic
925474044 2:4192815-4192837 GTCCTGAGGCTACACACAGCAGG + Intergenic
926280622 2:11442833-11442855 GTCCCAATGCAGCATAGAGCGGG + Intergenic
926316699 2:11715329-11715351 ATCCCCACCCTGCACAGAGCTGG + Intronic
926431061 2:12786081-12786103 ATCCCTAGGCTGCACACAGCAGG + Intergenic
926456545 2:13074262-13074284 GTCCTGAGGCTTCACACAGCAGG + Intergenic
926458507 2:13098949-13098971 GTCTTGAGGCTGCAAAGAGCAGG + Intergenic
926500196 2:13643863-13643885 GTCTCAAGGTTGCACAGAGCAGG - Intergenic
926519891 2:13897558-13897580 GTCCCAAGGCTGCACACAGCAGG - Intergenic
926538630 2:14146399-14146421 GTGCCAAGGTTGCATAGAACAGG - Intergenic
926682894 2:15677441-15677463 TTTCCAAAGCTGCCCAGAGCAGG + Intergenic
926836742 2:17031696-17031718 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
926840137 2:17070981-17071003 GTCCCTAGGCTGCACACAGCAGG - Intergenic
926860198 2:17301161-17301183 CCCTCAAGGCTGCACAGAGCTGG + Intergenic
926926460 2:17993141-17993163 GTCCCAAGGCTGAACAGAGCAGG - Intronic
926929639 2:18023950-18023972 GTCCCTAGGCTGCACACAGCAGG + Intronic
926938907 2:18114967-18114989 GTCCCTAAGCTGCACACAGCAGG - Intronic
927409297 2:22806339-22806361 GTCCCTAAGCTGCACACAGCAGG + Intergenic
928474841 2:31615854-31615876 GTCCCTAGGCTGCACACAGCAGG - Intergenic
928594244 2:32845417-32845439 GTCCTTAGGCTGCACACAGCAGG - Intergenic
928709452 2:33987805-33987827 GTCCCAAGGCTGAGCAGGACAGG + Intergenic
928927388 2:36593630-36593652 GTCCCTAGGCCGCATACAGCAGG + Intronic
929211278 2:39359843-39359865 GTCCCTAGGCTGCACACAGCAGG + Intronic
929275538 2:40021223-40021245 GTCCCTAGGCTGCATAGAGCAGG - Intergenic
930021014 2:47002256-47002278 ACCCCAAGGCTGCCCAGCGCTGG - Intronic
930227855 2:48812512-48812534 GTCCCTAGGCTGCACGCAGCAGG + Intergenic
930230108 2:48834840-48834862 GTCCCAAGGCTGCACAGAACAGG - Intergenic
930293974 2:49530369-49530391 GTCCCTAGGCTGCACACTGCAGG + Intergenic
930427877 2:51234363-51234385 GTCCCTAGGCTGCACACAGCAGG + Intergenic
930512067 2:52358392-52358414 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
930521290 2:52470703-52470725 GTCCTTAGGCTGCACACAGCAGG - Intergenic
930687509 2:54325371-54325393 GTTCCAAGGCTGCACAGAGCTGG - Intergenic
930939786 2:56999254-56999276 GTCCCAAGGCTACACAGACCAGG + Intergenic
931041404 2:58305066-58305088 CTCCTAAGGCTGCACACAGCAGG - Intergenic
931079421 2:58752736-58752758 GTCCTGAGACTGCACACAGCAGG - Intergenic
931494135 2:62783673-62783695 GTCCCAAGGCTGCACACAGCAGG + Intronic
931666767 2:64615379-64615401 GTCACATGGCTACACAGAGCTGG - Intergenic
932552506 2:72785672-72785694 ATCCCTAGGCTGCACACAGCAGG + Intronic
933006686 2:77004299-77004321 GTACGTAGGCTGCACACAGCAGG - Intronic
933085084 2:78045946-78045968 GTCCCTAGGCTGTACACAGCAGG - Intergenic
933539068 2:83616018-83616040 GTCCTAACGCTGCACAGAGCAGG - Intergenic
933548163 2:83740831-83740853 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
933994855 2:87660818-87660840 GTCCCGATGCTCCAGAGAGCAGG - Intergenic
934054965 2:88243855-88243877 GTCCCTAGGCTGCACACAGCAGG - Intergenic
935323074 2:101907210-101907232 GTTCTGAGGCTGCATAGAGCAGG + Intergenic
935385247 2:102492577-102492599 GTCCTAAGGCTGCATAGAGCAGG + Intronic
935419769 2:102854793-102854815 GTCCCTAGGCTGCACACAGTAGG + Intergenic
935497067 2:103794441-103794463 GTCCCTAGGCTCCACACAGCAGG + Intergenic
935724031 2:106007564-106007586 GTCCCTAGGTGGCACACAGCAGG - Intergenic
935797945 2:106663754-106663776 GTCCAGAGGCTGCACAGAGCAGG - Intergenic
935948930 2:108311692-108311714 GTCCCTAGGGTGCACACAGCAGG - Intergenic
936257512 2:110929711-110929733 GTCCCTAGGCTGCACACAGCAGG - Intronic
936299003 2:111290095-111290117 GTCCCGATGCTCCAGAGAGCAGG + Intergenic
936685538 2:114822357-114822379 GTCCCTAGGCTGCACACAGCAGG + Intronic
936753684 2:115678319-115678341 GTCCCAAGGCTGCACACAGCAGG - Intronic
936897564 2:117445686-117445708 GTCTCTAGGCTGCACACAGAAGG - Intergenic
937115105 2:119399319-119399341 GTCCCCAGGATGGACAGAGATGG - Intergenic
937229833 2:120391218-120391240 GTCCCAGGGGTGCCCAGAGATGG - Intergenic
937800580 2:126076786-126076808 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
937830183 2:126411410-126411432 GTGCCATGGTTGCTCAGAGCTGG - Intergenic
937870590 2:126783237-126783259 TTCCCAAGGGCGCACAGAGTGGG + Intergenic
938165348 2:129021163-129021185 GTCCTTAGGCTGCACAGACCAGG - Intergenic
938208544 2:129444382-129444404 GCACCAAGACTGCACAAAGCTGG - Intergenic
938763070 2:134442568-134442590 GGCCCAGGGCTGCACAGGGGAGG + Intronic
939052930 2:137329943-137329965 GTCCCAAGACTGCATACAGCAGG - Intronic
939110385 2:137999574-137999596 TTTCCAAGGCTGCACATAGCAGG - Intronic
939498312 2:142949622-142949644 GTCCCTAGTCTGCACACTGCAGG + Intronic
939784674 2:146494648-146494670 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
939830392 2:147064250-147064272 GTCCTGAGGTTGCACACAGCAGG - Intergenic
940426793 2:153540153-153540175 GTCTCTAGGCTGCACACAGCAGG - Intergenic
940444773 2:153764800-153764822 GTCCCTGGGCTGCACACAGCAGG - Intergenic
940505317 2:154546503-154546525 GTCCCTAGGCTGCACACAGCAGG - Intergenic
940547198 2:155102594-155102616 GTCCCTAGGCTTCACACAACAGG + Intergenic
940691311 2:156923989-156924011 GTTCCAAGGCTGCACACAGCAGG - Intergenic
940783655 2:157959391-157959413 GTCCAGAGGCTGCATAGAGCAGG + Intronic
941227262 2:162865283-162865305 GTCCTGAGGCTACACACAGCAGG + Intergenic
941319933 2:164041616-164041638 GTTGCTAGGCTGCACAGAGCAGG + Intergenic
941346215 2:164372409-164372431 GTCCTGAGGCTGCATAGAGCAGG - Intergenic
941445189 2:165591580-165591602 GTTCCCAGGCTGCACAGAACAGG - Intronic
941477552 2:165967933-165967955 GTCCCTAGGCTGCACACATATGG - Intergenic
941512987 2:166437178-166437200 GTCCCTAGGCTGCACACAGCAGG - Intronic
941526959 2:166618193-166618215 ATCGCAAGGCTGCACACAGCAGG - Intergenic
941682654 2:168415303-168415325 GTCCCAAGGCTGCACACAGCAGG + Intergenic
941967243 2:171312409-171312431 ATCCCAAGGCTGCACACAGCAGG - Intergenic
941977708 2:171423980-171424002 GTCCTGAGGCTGCACACAGTAGG - Intronic
942118203 2:172749515-172749537 GTCCCTAGGCCGCACACAGCAGG + Intronic
942260018 2:174150301-174150323 GTCCCAAGGCAGCACAGCACAGG - Intronic
942829693 2:180225084-180225106 GTCCTGAGGCTGCATAGAGCAGG - Intergenic
942846189 2:180428785-180428807 GTCCCAAGGTTGCACACAGCAGG + Intergenic
942880753 2:180857897-180857919 ATCCCTAGGCTGCACACAGCAGG + Intergenic
942904769 2:181167091-181167113 GTCCCTAGGCTGCACACAGCAGG + Intergenic
943223534 2:185140229-185140251 GTTCCAAAGCTGCATAGAACAGG + Intergenic
943372079 2:187028165-187028187 ATCCCAAGGCTTCACAGAGCAGG - Intergenic
943620254 2:190140635-190140657 GTCCTGAGGCTGCATACAGCAGG + Intronic
943788142 2:191901309-191901331 GTCACTAGGCTGCACACAACAGG - Intergenic
943804883 2:192111783-192111805 CTCCCTAGCCTGCACATAGCAGG - Intronic
943880708 2:193140654-193140676 GTCCAAAGGCTGCGGATAGCAGG + Intergenic
943936056 2:193918679-193918701 GTCCCAAGGAGGCACAGAGCAGG - Intergenic
944010174 2:194965285-194965307 GTCCCTAGGCTGAACATAGCAGG + Intergenic
944011489 2:194979727-194979749 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
944272244 2:197796555-197796577 GTCTCTAGGCTGCACACAGTAGG + Intergenic
944303915 2:198157540-198157562 ATACCTAGGCTGCACACAGCAGG - Intronic
944477945 2:200126056-200126078 TTCCCAAGGCTGTACACAGAAGG + Intergenic
944494344 2:200291207-200291229 GTCCCTGGGCTGAACTGAGCAGG + Intergenic
945151093 2:206792863-206792885 TGCCCAAGGCTACACAGAGTAGG + Intergenic
945333306 2:208563296-208563318 GTCCTGAGACTGCATAGAGCAGG + Intronic
945336641 2:208600077-208600099 ATCCCAAGGCTGCACAGAGCAGG + Intronic
945455568 2:210048080-210048102 ATACTGAGGCTGCACAGAGCAGG - Intronic
945456317 2:210056054-210056076 ACCCCAAGGCTGCACAGAGCAGG - Intronic
945495313 2:210501136-210501158 GTCTCTAGGCTGCACACATCGGG + Intronic
946108278 2:217391140-217391162 GTCCCTAGGCTGCACACAGCAGG + Intronic
946452240 2:219790354-219790376 GGCCCAAAGTTACACAGAGCTGG - Intergenic
946562244 2:220926422-220926444 GTACTTAGGCTGCACACAGCAGG + Intergenic
946635793 2:221724350-221724372 GTTCCTAGGCTGCACATACCAGG - Intergenic
946844862 2:223850336-223850358 GACCCTAGGCTGCACATAGCAGG - Intergenic
946874475 2:224114160-224114182 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
946898153 2:224345650-224345672 GTCCCAAGGCTGCACAGTCAGGG + Intergenic
947070206 2:226280513-226280535 GTCTCGAGGGTGCACATAGCAGG - Intergenic
947248536 2:228076955-228076977 GACTCTAGGCTGCACATAGCAGG - Intronic
947396657 2:229694015-229694037 GTCCCAAGGCTGCAAAGAGTGGG - Intronic
947886543 2:233576558-233576580 GTCCCTAGGCTGCACACAGCAGG + Intergenic
947888535 2:233595518-233595540 GTCCCTAGGCTACACACACCAGG - Intergenic
947893461 2:233646198-233646220 GTCCCTAGGCTGCACACAGCAGG + Intronic
947904493 2:233750631-233750653 GTCCTGAGGCTGCACACAGCAGG - Intronic
948016773 2:234697457-234697479 GTCCTGAGGCTTCACACAGCAGG + Intergenic
948501376 2:238397395-238397417 GTCCAAAGGCAGAACAGGGCCGG - Intronic
948699693 2:239751870-239751892 TCCCCAAGCCTGCACAGTGCAGG - Intergenic
948853530 2:240719720-240719742 GTCCCCTGTCAGCACAGAGCTGG + Intronic
948878890 2:240845729-240845751 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1169592811 20:7163940-7163962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1169593961 20:7176960-7176982 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1171883500 20:30634701-30634723 GTCCTGAGGCTGCACATAGAGGG + Intergenic
1172870436 20:38132290-38132312 GTCCCAGGGCAGCTCAGCGCTGG - Intronic
1173323455 20:42010279-42010301 GTCCTGGGGCTGCACACAGCAGG + Intergenic
1173412732 20:42828602-42828624 GTTCCTAGGCTGCCCACAGCAGG - Intronic
1173491655 20:43487463-43487485 GTCCCTAGGCTACACAGAGCAGG + Intergenic
1175100293 20:56574594-56574616 CTGCGAAGGCTGCACACAGCGGG - Intergenic
1175195405 20:57239873-57239895 GTCCCTAGGGTGCACACAGCAGG + Intronic
1175466725 20:59194448-59194470 GCCCCCAGGCTGGCCAGAGCTGG + Exonic
1175655465 20:60765997-60766019 GTGCCATGCCTGCACAGACCTGG - Intergenic
1175708754 20:61202383-61202405 GTCCCGAGGGTAGACAGAGCTGG - Intergenic
1176650238 21:9539335-9539357 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1176845888 21:13876130-13876152 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1176848621 21:13895673-13895695 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1177223032 21:18218433-18218455 GTCCCTAGGCTGCACACAGTAGG + Intronic
1177259569 21:18712525-18712547 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1177359523 21:20049989-20050011 GTCCTGAGGCTGTACACAGCAGG - Intergenic
1177471323 21:21563995-21564017 GTCCCTAGTGTGCACACAGCAGG - Intergenic
1177473062 21:21583915-21583937 GTCTTGAGACTGCACAGAGCTGG - Intergenic
1177496171 21:21894935-21894957 GTCCTGAGGCTTCACAGAGGAGG + Intergenic
1177606003 21:23378791-23378813 GTCCTGTGGCTGCACACAGCAGG - Intergenic
1177761019 21:25402270-25402292 GTCCCTAGGCTACACACAGCAGG - Intergenic
1177881714 21:26702549-26702571 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1177990539 21:28030570-28030592 AACCCTAGGCTGCACACAGCTGG + Intergenic
1178011359 21:28290354-28290376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178037428 21:28600450-28600472 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178046211 21:28696960-28696982 GTCCGGAGGCTGCACACAGCAGG + Intergenic
1178127056 21:29526979-29527001 GTCCTGAGGCTGCATAGAGCAGG + Intronic
1178143931 21:29716949-29716971 GTCCTGAGGCTGTACAGAGCGGG - Intronic
1178173961 21:30075746-30075768 GTCCCTAGGCTGCACACACCAGG - Intergenic
1178261905 21:31107310-31107332 GTCCCTAGGCTGCACTCAGCAGG + Intergenic
1178634255 21:34288462-34288484 GTCCATAGGCTGCACACAGCAGG + Intergenic
1178682029 21:34680322-34680344 GTCCCTAGGCTGCACACAGCAGG + Intronic
1179271980 21:39858586-39858608 GTCTCGAGGCTGCACACAGCAGG + Intergenic
1179384475 21:40929325-40929347 GACCCTAGACTGCACATAGCAGG + Intergenic
1179994076 21:44965972-44965994 TTCCCAAGGCTGTGGAGAGCTGG + Intronic
1180152982 21:45961563-45961585 GTCCCAAGGCTGCACACTGCAGG + Intergenic
1180685722 22:17664859-17664881 GTCCAGAGGCTGCACACAGCAGG + Intronic
1180700837 22:17780779-17780801 GTTCCAAGGGTGCACTGAGAAGG - Intergenic
1181808895 22:25391674-25391696 GTCCTGAGGCTGCAGAGAGGTGG - Intronic
1181992414 22:26847455-26847477 GTGCCATGTCTGCAAAGAGCAGG - Intergenic
1182650666 22:31848568-31848590 GTCCCTAGGCAGCACACAGCAGG + Intronic
1183847360 22:40553404-40553426 GTCCTGAGGCTGCACAGAGCAGG - Intronic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1184033547 22:41908293-41908315 GTCCCACAGCTGTGCAGAGCTGG - Intergenic
1184338852 22:43874388-43874410 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1184387295 22:44183304-44183326 CTCCCAAGCCTGCACAGAGGAGG - Exonic
1184890206 22:47374696-47374718 GACCCAAGTCAGCGCAGAGCAGG + Intergenic
1184942359 22:47778366-47778388 CTCCCAAGGCTCCAGAGGGCAGG + Intergenic
1185048062 22:48538864-48538886 GTCCCCAGGGCCCACAGAGCAGG + Intronic
949261443 3:2106587-2106609 GTCCCTAGGCTGTACACAGCAGG + Intronic
949292424 3:2482631-2482653 GTCCCTAAGCTGCATAAAGCAGG - Intronic
949635994 3:5981863-5981885 GTCCCTAGACTTCACACAGCAGG + Intergenic
950154116 3:10709051-10709073 ATCCCAGGGCTGCAGAGAGCAGG - Intergenic
950315088 3:11995101-11995123 GCCCCAGAGCTCCACAGAGCTGG - Intergenic
950412184 3:12846200-12846222 GTCCCTAGGCTGCACACTGCAGG - Intronic
950806136 3:15604403-15604425 GTCCCTAGGCTGCAAACAGCAGG + Intronic
950853138 3:16081793-16081815 GTCTCTAAGTTGCACAGAGCAGG + Intergenic
951132863 3:19068983-19069005 GTGTCAAGGCTGCACAAAACAGG - Intergenic
951192481 3:19786569-19786591 GTCCCTAGGCTGCACACAACAGG - Intergenic
951446178 3:22782789-22782811 GTCCCTAGACTGCACACAGCAGG + Intergenic
951801767 3:26603916-26603938 GTCCCTAGGCTGCACACAGCAGG + Intergenic
952029082 3:29119741-29119763 ATCCCTAGGGTGCACACAGCAGG - Intergenic
952141134 3:30480334-30480356 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
952504555 3:33996032-33996054 GTCCTGAGGCTGCACAGAACAGG + Intergenic
952575799 3:34773089-34773111 GTTCCTAGGCTGCACACAGCAGG - Intergenic
952608753 3:35181755-35181777 GTCCTGAGGCTACATAGAGCAGG + Intergenic
952624905 3:35392347-35392369 GTCCCTAGGCTGCACACAGCAGG + Intergenic
952831435 3:37568279-37568301 GTCCCTAGGCTGCACAGAGCAGG + Intronic
953376522 3:42432851-42432873 GGGGCAAGGCTGGACAGAGCAGG + Intergenic
953962410 3:47276751-47276773 GTCTCAATGCTGCCCAGAGTAGG + Intronic
954371435 3:50171374-50171396 GGCCCAAGGCTGCGCAGGGTTGG + Intronic
954389070 3:50259560-50259582 GACCCAAGGCTGCAGAGTACTGG - Intergenic
955826268 3:62951269-62951291 GTCCCTAGGCTGCACACAGCAGG - Intergenic
956327544 3:68070388-68070410 ATCCCTAGGCTGCACACAGCAGG + Intronic
957300887 3:78390161-78390183 GTCCCGAGGCTGCATAGAGTAGG - Intergenic
957374290 3:79336343-79336365 GTACCAAAGCTACAAAGAGCAGG - Intronic
957403632 3:79749589-79749611 GTCCCTAGGCTGAACAGAGTAGG - Intronic
957457626 3:80472693-80472715 GTTCCTAGGCTGCACAGAGCTGG - Intergenic
957471809 3:80668325-80668347 ATCCAGAGGCTGCACACAGCAGG - Intergenic
957477142 3:80739620-80739642 GTCCCGAGATTGCACAGATCAGG + Intergenic
957490556 3:80921507-80921529 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
957676802 3:83377629-83377651 GTCCCAAGGCTGCATAGGGTAGG + Intergenic
957765765 3:84621988-84622010 GTCCCAAGGCTGCATACAGCAGG + Intergenic
957909479 3:86603511-86603533 GTCCTGAGGCTGCACAGAACAGG - Intergenic
957949501 3:87107024-87107046 GTCCTGAGGCTGCTCACAGCAGG - Intergenic
957982255 3:87525405-87525427 GTCCCAAGGCTGCACAGAGATGG - Intergenic
958018378 3:87968879-87968901 GTCCCCAGGCTGCATACAACAGG - Intergenic
958050315 3:88335960-88335982 GTCCCTAGGCTGCATACAGCAGG + Intergenic
958128357 3:89386331-89386353 GTCTCAATGCTGCACACAGCAGG - Intronic
958151746 3:89701187-89701209 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
958469365 3:94498473-94498495 GTCTCAAGGCTGCACTGAAGAGG - Intergenic
958528362 3:95291776-95291798 GTCATGAGGCTGCATAGAGCTGG - Intergenic
958637437 3:96763293-96763315 GTCTCAAGGTTGTACAGAACAGG - Intergenic
958857162 3:99398967-99398989 GTCACTAGGCTGCACACAGCAGG + Intergenic
958860979 3:99445339-99445361 GGCCGTAGGCTGCACACAGCAGG - Intergenic
958955183 3:100458977-100458999 AATCCAAGGCTGCACACAGCAGG + Intergenic
959054430 3:101553609-101553631 GTCCCTAAGCTGCACACAGCAGG - Intergenic
959172553 3:102860256-102860278 GTCCCTAGGCTGCACAGAACAGG + Intergenic
959267977 3:104167976-104167998 GTCCCTAGGATGCACACAGCAGG + Intergenic
959381073 3:105641836-105641858 GTCCTTAGGCTGCACACAGCAGG + Intergenic
959453542 3:106532169-106532191 GTCCCTAGGCTGCATCCAGCAGG - Intergenic
959609600 3:108278582-108278604 GTCCCTAGGATACACACAGCAGG + Intergenic
959803553 3:110524748-110524770 GTCCCTAGGCTGCACACAGCAGG - Intergenic
959846570 3:111040391-111040413 GTCCCTAGGCTGCACACAGCAGG - Intergenic
960224902 3:115157761-115157783 GTCTGGAGGCTGCACAGAGCAGG - Intergenic
960255346 3:115505719-115505741 GTCTCAAGGCTGCACATAGCAGG - Intergenic
960341345 3:116478929-116478951 GTCCCTAGGCTGCACACAGCAGG - Intronic
960362851 3:116735245-116735267 GTCTTAAGGCTGCACACAGCAGG - Intronic
961315822 3:126035000-126035022 GAGCGAAGGCTGCACAAAGCAGG + Intronic
961378752 3:126483505-126483527 GGCCCAACACTGCACAGAGCAGG + Intronic
961503844 3:127357007-127357029 GCCCCAAGGCTGCATAGAGCAGG + Intergenic
961741199 3:129034094-129034116 TCTCCAAGGCTGGACAGAGCGGG + Intronic
962066974 3:131991798-131991820 ATCCTAAGGCTGCACAGAGCAGG - Intronic
962162200 3:133011849-133011871 GTCCCTAGGCTGCACATAGCAGG + Intergenic
962421615 3:135233924-135233946 GTTCCAAGGCTCCACACAGTAGG + Intronic
962460985 3:135612564-135612586 GTCCCTAGGCTGCACACAGCAGG - Intergenic
962509456 3:136084207-136084229 GTTCAGAGGCTGCATAGAGCAGG - Intronic
962646447 3:137445270-137445292 GCCCCAAGGCTGCACAGAGCAGG + Intergenic
963129521 3:141845558-141845580 GTCCCACGTCTGCACAGGGGAGG + Intergenic
963258987 3:143175396-143175418 TCTCCAAGGCTGCACAGAGAGGG + Intergenic
963297083 3:143558058-143558080 GTCCTGAGGCTGCACAGAGCAGG - Intronic
963363251 3:144303414-144303436 GTCCTTAGGCTACACACAGCAGG + Intergenic
963391183 3:144665798-144665820 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
963433755 3:145242060-145242082 GTCCTGAAGCTGCACACAGCAGG + Intergenic
963515815 3:146306662-146306684 GTGCCTAGGCTGCATAGAGTAGG + Intergenic
963516609 3:146316879-146316901 GTCCCAAGGCTGCATAGAGCTGG + Intergenic
963671585 3:148258339-148258361 GTCCCAAGGCTGCACAAAGCAGG - Intergenic
964090888 3:152874277-152874299 GTTCAGAGGCTGCATAGAGCAGG + Intergenic
964605500 3:158556151-158556173 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
964792980 3:160470381-160470403 GTCTCGAGGCTGCACAAAGAAGG - Intronic
964989144 3:162785155-162785177 GTCCCAAGGCTGCATAGAGTAGG + Intergenic
965025119 3:163291910-163291932 GTCCCTAGGCTGCACACAGAAGG + Intergenic
965031102 3:163369347-163369369 GTCCCAAGGCTGCACACAGCAGG + Intergenic
965065434 3:163841442-163841464 GTCTCGAGGCTGCACAGAGCGGG + Intergenic
965092856 3:164183844-164183866 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
965108449 3:164388402-164388424 GTCCCTAGGCTGGACAGAGCAGG + Intergenic
965249775 3:166327938-166327960 GTTCTGAGACTGCACAGAGCTGG + Intergenic
965265051 3:166532143-166532165 GTCCCAAGGCTACATAGAGTAGG + Intergenic
965270734 3:166614044-166614066 GTCCCTAGGCTGCACAAAGCTGG + Intergenic
965305569 3:167059488-167059510 GTCCCTAGACTGCACACAGCAGG + Intergenic
965614108 3:170575626-170575648 TCCCAAAGGCAGCACAGAGCAGG + Intronic
965649463 3:170918931-170918953 GTCCCCAGACTGCACACAGCAGG - Intergenic
965854647 3:173073439-173073461 GTCCCTAGGCTGCACACAGCAGG - Intronic
966325279 3:178746369-178746391 GTTCCTAGGCTGCACACAGCTGG + Intronic
966466287 3:180234045-180234067 GTCCCTAAATTGCACAGAGCAGG + Intergenic
966512208 3:180776631-180776653 GTCCCTAGGCTGCACACACCTGG + Intronic
966741958 3:183242421-183242443 GTCCCTAGACTGCATAGAGCAGG - Intronic
966972787 3:185060860-185060882 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
967412531 3:189181109-189181131 GTCCCTAGGCTGCACAAGGATGG + Intronic
967453333 3:189651775-189651797 GTCCCGAGGCTGCACAGAGCAGG - Intronic
967622587 3:191651080-191651102 GTCCCTGGGCTTCACACAGCAGG + Intergenic
967751490 3:193121158-193121180 CTGCGGAGGCTGCACAGAGCCGG - Intergenic
967971032 3:194999659-194999681 GCAGCAAGGCTGCCCAGAGCTGG + Intergenic
968175898 3:196549288-196549310 GTCCCTAGGCTGCACACAGCAGG - Intergenic
968295108 3:197570515-197570537 GTCCCTAAGATGCACACAGCAGG - Intronic
968313986 3:197706980-197707002 GTCCCACGGCTGCCCAGCCCTGG - Intronic
968350798 3:198050224-198050246 GTCCTGAGGCTGCACATAGAGGG + Intergenic
968380682 4:93277-93299 GTCCTGAGACTGCACACAGCAGG + Intergenic
968392203 4:203042-203064 GTCCTTAGGATGCACAAAGCAGG - Intergenic
968510308 4:992643-992665 GTCCCGAGGCAGCACCGAGAGGG + Intronic
968767144 4:2478501-2478523 GCCCCTAGGCTGCACACAGCAGG - Intronic
968892893 4:3380745-3380767 GTCCTGAGGTTGCATAGAGCAGG + Intronic
969217025 4:5730994-5731016 GTCCTTCGCCTGCACAGAGCAGG - Intronic
969313884 4:6370128-6370150 GTCCCAGGGCTGCAGGGGGCAGG + Intronic
970099387 4:12503297-12503319 GGTCCAAGGCTGGACAGTGCAGG + Intergenic
970721866 4:18997476-18997498 ATCCTCAGGCTGCACACAGCAGG + Intergenic
970756815 4:19437193-19437215 ATCCCAAGGCTGCACACAGCAGG - Intergenic
970758163 4:19451091-19451113 GTCACATGGCTGCACAGAGCAGG + Intergenic
970788464 4:19828484-19828506 GTCCCAAGGCTGCACAGAGTAGG - Intergenic
970818917 4:20190585-20190607 GTCTCTAGGCTGCACAGAGCAGG - Intergenic
970999244 4:22303843-22303865 ATCCCTAGGCTGCACACAGCAGG - Intergenic
971358400 4:25914546-25914568 GTCACAAAGCTGCACATGGCAGG - Intronic
971440424 4:26679253-26679275 GTCCTGAGGCTGCACAGAGCAGG - Intronic
971561550 4:28084598-28084620 GTCCCAAGGCTGCACACAGCAGG + Intergenic
971631447 4:28998462-28998484 CTCCCAAGGCTGCACAGAGCAGG - Intergenic
971670277 4:29546876-29546898 GTCCCTAGGCTGCACAGAACAGG + Intergenic
971681517 4:29706844-29706866 GTCCCTAGGCTGCACACAGCAGG + Intergenic
971796799 4:31238826-31238848 GTCCCAAGAGGGCACTGAGCTGG - Intergenic
971845762 4:31916214-31916236 GTCTTGAGGCTGCACAGAGCAGG - Intergenic
971857130 4:32058291-32058313 GTCCCTAGGTGGCACACAGCAGG + Intergenic
971912359 4:32810470-32810492 GTCCTGAGGCTGCACACAGCAGG + Intergenic
971972196 4:33634906-33634928 GTTCCAGGGCTGCACAGAGGAGG - Intergenic
972012826 4:34205930-34205952 GTCCTGAGGCTTCACAGAGCAGG - Intergenic
972051698 4:34743212-34743234 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
972063411 4:34909974-34909996 GTCCCTAGGCTGTACATAGAAGG - Intergenic
972087770 4:35241609-35241631 GTTCCTAGGCTGCATACAGCAGG - Intergenic
972087790 4:35241720-35241742 GTTCCTAGGCTGCATACAGCAGG - Intergenic
972102950 4:35445546-35445568 GGCCCAAGGCTGCAGAGAGCAGG - Intergenic
972190629 4:36587028-36587050 GTCCCTAAGCTGCACACAGCAGG - Intergenic
972199937 4:36702577-36702599 GTCCCGAGGCTGCATAGAGCAGG - Intergenic
972268140 4:37482781-37482803 GTCCTGAGGCTGCACAGAGCAGG - Intronic
972283274 4:37623609-37623631 CTACCTAGGCTTCACAGAGCAGG + Intronic
972301205 4:37787320-37787342 GTCCCTAGGCTGCACACAGCAGG - Intergenic
972832672 4:42832721-42832743 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
972872106 4:43312964-43312986 GTCCTTAGGCTACACACAGCAGG - Intergenic
972879495 4:43406585-43406607 GTCCTGAGGCTGCACACAGCAGG - Intergenic
972887533 4:43510475-43510497 AACCCTAGGCTGCACACAGCAGG + Intergenic
973107748 4:46361280-46361302 GTCCCTATACTGCACACAGCAGG - Intronic
973367151 4:49216973-49216995 GTCCTGAGGCTGCACATAGAGGG + Intergenic
974171235 4:58269958-58269980 GTCCCTAGGCTGCACACAGCAGG - Intergenic
974311003 4:60209806-60209828 GTTCCAAGGCTGCACAGAGCAGG + Intergenic
974322483 4:60369274-60369296 TTCCCTAAGCTGCACACAGCAGG - Intergenic
974620377 4:64346614-64346636 GTCCTGAGACTGCACAGATCAGG + Intronic
974666576 4:64969707-64969729 GTCCTGAGGCTGCACATAGCAGG + Intergenic
974702778 4:65472695-65472717 GTGCCACAGTTGCACAGAGCAGG + Intronic
974733577 4:65900041-65900063 GTCCCTAAGCTACACACAGCAGG - Intergenic
974742275 4:66022019-66022041 GTTCCAAGGCTGCACAGAGCAGG + Intergenic
974748125 4:66102693-66102715 GTCCCTAAGCTGCACATAGCAGG - Intergenic
974797082 4:66766769-66766791 ATCCCTAGACTGCACACAGCAGG - Intergenic
974832853 4:67210942-67210964 GTCTCTAGGCTGCAAACAGCAGG - Intergenic
974843367 4:67323242-67323264 GTCTCAAGAATGCACACAGCAGG - Intergenic
974923479 4:68270390-68270412 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
974931422 4:68365289-68365311 GTCCCAAAGCTGTACAAAGCAGG - Intergenic
974972249 4:68844814-68844836 GTTGCTAGGCTGCACACAGCAGG - Intergenic
975040471 4:69739518-69739540 GTCCCTAGACTGCACATAGCAGG + Intronic
975046201 4:69807565-69807587 GTCCCTAGCCTGCACACAGTAGG - Intergenic
975204077 4:71624237-71624259 GTCCCTGGGCTGCACACAGTAGG + Intergenic
975307316 4:72865203-72865225 GTCCAGAGGCTGCATAGAGAAGG - Intergenic
975361337 4:73475299-73475321 ATCCCAAGGCTTCACACAGCAGG + Intergenic
976042749 4:80906771-80906793 GTCTCAAGGCTCCATAGAACAGG + Intronic
976365779 4:84230732-84230754 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
976442246 4:85089007-85089029 GTCCCAAGGCTGCACACAGCAGG - Intergenic
976678095 4:87725508-87725530 TCACCAAGGCTGCACAGAGGAGG - Intergenic
976952437 4:90850001-90850023 GTCCCAAGGCTGCACAGAGCAGG - Intronic
977041479 4:92024629-92024651 TTTCCTAGGCTGCACACAGCAGG + Intergenic
977063827 4:92288500-92288522 GTCCCAAGGTTGCACAAAGTAGG + Intergenic
977197531 4:94081541-94081563 GTCCTGAGGCTGTATAGAGCAGG + Intergenic
977356424 4:95952695-95952717 GTTTCAAGGCTACATAGAGCAGG + Intergenic
977441225 4:97070466-97070488 GTCCCAAGAGGGCACTGAGCTGG + Intergenic
977545024 4:98367128-98367150 GTTCCTAGGCTGCACAGAGTAGG - Intronic
977702538 4:100036331-100036353 ATCCCTAGGCTGCACACAGCAGG + Intergenic
977707392 4:100086839-100086861 GCCCCAAGGCTGCTCAGGGGAGG + Intergenic
977952866 4:102993932-102993954 GTCTCAAGGCTGCATAGAGCAGG + Intronic
978234963 4:106446962-106446984 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
978265878 4:106823488-106823510 GTCCCAAGGCTATACACAGCAGG + Intergenic
978355767 4:107871551-107871573 GACCCAATTCTGCACAGAACAGG + Intronic
978920994 4:114183103-114183125 GTCCCTAGGCTACACACAGCAGG - Intergenic
978934172 4:114355127-114355149 GTCCCTAGGCTGCATGGACCTGG + Intergenic
979038358 4:115754401-115754423 GTCCCTAAGCTGCATACAGCAGG - Intergenic
979078373 4:116303525-116303547 GTCCCTAGGCAGCACAGAGCAGG - Intergenic
979125647 4:116968953-116968975 GTCATGAGGCTGCACAGAGCAGG + Intergenic
979137482 4:117127863-117127885 GTCCCCAGGTTGCATAGAGCAGG - Intergenic
979356494 4:119712115-119712137 GTCCATAGGCTGCACACAGCAGG - Intergenic
979412560 4:120396361-120396383 GTCCCTATGCTGCACACAGTAGG + Intergenic
979700041 4:123656892-123656914 GTCCCTAGGCTGCACACAGCAGG + Intergenic
979764424 4:124446960-124446982 ATCCCCAGGCTGCATACAGCAGG + Intergenic
979867630 4:125776369-125776391 GTCCCTAGGCTGCACACAGCAGG - Intergenic
979906555 4:126300724-126300746 GTCCTGAGACTGCACAGAGTAGG + Intergenic
979966860 4:127086477-127086499 GTCCCGAGGCTGCATAGAGTTGG - Intergenic
980242240 4:130191610-130191632 GTCCCAAGGCTGCACACAGTTGG + Intergenic
980280108 4:130707669-130707691 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
980292421 4:130860283-130860305 GTCCCTAGGCTGCACACAGCAGG - Intergenic
980324446 4:131323913-131323935 GTCCCTAGGCTGCACAAACAAGG - Intergenic
980386046 4:132089035-132089057 GTCCCAAGTCTGCACACAGCAGG - Intergenic
980430190 4:132684122-132684144 GTCCTGAGGCTGCACACAGCAGG + Intergenic
980523208 4:133957893-133957915 GTCCTGAGGCTGCGCAGAGCAGG + Intergenic
980532599 4:134073894-134073916 GTCCCGAGGCTGCACAGAGCAGG + Intergenic
980646086 4:135644058-135644080 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
980650747 4:135711898-135711920 GTCCCAAAACTGCAAAGAGCAGG - Intergenic
980670208 4:135994979-135995001 GTCCCTAGGCTGCATACAGCAGG + Intergenic
980758028 4:137190932-137190954 GTCTCAAGGCTACACAGAGCAGG + Intergenic
980767121 4:137321251-137321273 GTCCCCAGGCTACACACAGCAGG + Intergenic
981242365 4:142492973-142492995 GTGCCAAGGCTGCATAGAGCAGG - Intronic
981359600 4:143831438-143831460 GACCTGAGGCTGCACAGAGCAGG - Intergenic
981370359 4:143952506-143952528 GACCTGAGGCTGCACAGAGCAGG - Intergenic
981380118 4:144062430-144062452 GACCTGAGGCTGCACAGAGCAGG - Intergenic
981412009 4:144442841-144442863 ATGCCGAGGCTGCACAGAGCAGG + Intergenic
981915340 4:150026945-150026967 GTCCCAAGGCTGTGCACAGCAGG - Intergenic
982075982 4:151737700-151737722 GTCCCTAGACTGCACACAGCAGG - Intronic
982098642 4:151946912-151946934 GTCCCTAGGCTGTACACAGCAGG - Intergenic
982430311 4:155315079-155315101 GTCCCTAGGTAGCACACAGCAGG - Intergenic
982854392 4:160362634-160362656 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
982920429 4:161267295-161267317 GTGCCAAGGCTGCATAGAGCAGG + Intergenic
983006372 4:162490264-162490286 GTCCCAAGGTCGCAAAGAGCAGG - Intergenic
983105620 4:163682504-163682526 GTCTCGAGGCTGCACAGAGCAGG - Intronic
983337532 4:166415992-166416014 CTCCCTAGGCAGCACACAGCAGG + Intergenic
983657532 4:170098365-170098387 GTCCTTAGGCTGCACACAGCAGG + Intergenic
983718456 4:170816027-170816049 GTCCCTAGGTTGCACCCAGCAGG - Intergenic
983825108 4:172249612-172249634 ATCCTGAGACTGCACAGAGCAGG - Intronic
983854972 4:172632815-172632837 GCCCCAAGGCTGCATGGAGCAGG - Intronic
983874726 4:172862917-172862939 GTCCCTAGGCTGCACATAGCAGG - Intronic
983889457 4:173015933-173015955 GTCCTGAGGCCACACAGAGCAGG - Intronic
984065564 4:175043733-175043755 GTCCTGAGGCTGCACAGGGCAGG - Intergenic
984219494 4:176955649-176955671 GTCTTCAGGCTGCACAGAGCAGG + Intergenic
984318591 4:178161460-178161482 CTCTCAAGTCTGCACACAGCAGG + Intergenic
984707382 4:182857581-182857603 GGCCCAAGGCAGAGCAGAGCAGG - Intergenic
985394279 4:189525520-189525542 GTCCCTAGGGTGCACACAGCAGG - Intergenic
985474095 5:68462-68484 GTCCCTAGGCTGCACATAGCAGG - Intergenic
985480391 5:107004-107026 TTCCCATGTCTGCACTGAGCAGG - Intergenic
985588993 5:755197-755219 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985603673 5:847713-847735 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985778754 5:1858676-1858698 GCCCCAGGCCTGGACAGAGCAGG - Intergenic
986537487 5:8805881-8805903 GTCCCTAGGCTGCAAACAGAAGG - Intergenic
986557645 5:9027297-9027319 GTCCTGAGGCTTCATAGAGCAGG - Intergenic
986640631 5:9868497-9868519 GTTCCTAGGTTGCACACAGCAGG + Intergenic
986678495 5:10211619-10211641 CACCCCAGGCTGCACAGAGCAGG - Intergenic
986707643 5:10464524-10464546 GTCCCAAGCCTCCAAAGAACTGG + Intronic
987005288 5:13704068-13704090 GACCCAAGGATGCACCCAGCTGG + Intronic
987016691 5:13827425-13827447 GTCCCATGCCTACACACAGCAGG - Intronic
987169577 5:15240350-15240372 ATTCTGAGGCTGCACAGAGCAGG - Intergenic
987216602 5:15743982-15744004 GTCCCAAGGCTGCACACATCAGG + Intronic
987457580 5:18165853-18165875 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
987514574 5:18888921-18888943 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
987562412 5:19540754-19540776 GTACCTAGGCTGCACACAGCAGG + Intronic
987610649 5:20198788-20198810 GTCCCTGGGCTGCACACAGCAGG - Intronic
987642388 5:20629023-20629045 GTCCCAAGACTGCATACATCAGG + Intergenic
987659535 5:20854832-20854854 GTTCCTAGGCTGCACACAGCAGG - Intergenic
987709071 5:21486156-21486178 GTTCCTAGGCTGCACACAGCAGG + Intergenic
987810373 5:22827102-22827124 GTCCCTAGGCTGCACACACAGGG - Intronic
988080644 5:26410647-26410669 GTCCCAAGGACACACAGAGCAGG - Intergenic
988172979 5:27683079-27683101 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
988345710 5:30035572-30035594 GTCCTGAGGCTGCACACAGTAGG - Intergenic
988353534 5:30143026-30143048 GTACCAAAGATGCACAAAGCTGG + Intergenic
988396291 5:30700941-30700963 GTCCTAAGGCTGCACACAACAGG - Intergenic
988473910 5:31565846-31565868 GTCCTGAGGCTACACAGAGCAGG + Intergenic
988603132 5:32657484-32657506 GTCCCTGGGCTGCACAGAGCAGG + Intergenic
988750541 5:34187997-34188019 GTTCCTAGGCTGCACACAGCAGG - Intergenic
988764110 5:34350814-34350836 GTTCCTAGGCTGCACACAGCAGG + Intergenic
988768390 5:34406664-34406686 GTCCCAAAACTGCACAGAGCAGG - Intergenic
988858569 5:35253093-35253115 GTCCCAAGGCTGCACACAGTAGG + Intergenic
988911247 5:35845913-35845935 ATGCCAAGGCTGCACGTAGCAGG + Intergenic
989067831 5:37481563-37481585 GTTACTAGGCTGCACACAGCAGG + Intronic
989132814 5:38124469-38124491 GTCCTGAGGCTGCATACAGCAGG + Intergenic
989218329 5:38927570-38927592 GTCCTGAGGCGGCACAGAGCAGG + Intronic
989279242 5:39622105-39622127 GCCCAAAGGCAGCACAGGGCTGG + Intergenic
989399436 5:40993137-40993159 GTCTTGAGGCTGCACAGAGCAGG + Intergenic
989405935 5:41060659-41060681 GTGACAAGGGTGCACAGAGAGGG - Intronic
989516313 5:42348012-42348034 GTCCCTAGGTTGCACAAAGTAGG - Intergenic
989523674 5:42428342-42428364 GTACCTAGGCTGCACCTAGCAGG + Intronic
989726884 5:44597535-44597557 GTCCCAAGGCTGCACACAGCAGG + Intergenic
989753385 5:44922519-44922541 GTCCCAAGGCTGCACAGAGTAGG - Intergenic
989787104 5:45345216-45345238 GTCCCTAGGCTGCACACAGCAGG + Intronic
989966846 5:50475072-50475094 GATCCTAGGCTGCACAGAGCAGG - Intergenic
990021110 5:51128467-51128489 GTCTCGAGGCTGCACAGAGCAGG - Intergenic
990023678 5:51159771-51159793 GGGCCAAGGCAGCACAGGGCTGG - Intergenic
990077809 5:51872993-51873015 GTCCCTAGGCTGCACACAGAAGG - Intergenic
990083374 5:51944695-51944717 GTCCCAAGGCTGCAGAGAGCAGG - Intergenic
990108466 5:52293377-52293399 ATCCTGAGGCTGCACACAGCAGG + Intergenic
990143345 5:52730971-52730993 GTCCTGAGGCTGCACATAGCAGG - Intergenic
990198104 5:53341815-53341837 GTCCAATGGCTGCTCAAAGCAGG + Intergenic
990231186 5:53714826-53714848 CTCCCAAGGCTGCAAAGAACAGG + Intergenic
990264521 5:54061152-54061174 GTCCCTAGGCTGCACACAGCTGG - Intronic
990903611 5:60779583-60779605 GTCCCTAGGCTGCACACAGCAGG + Intronic
991039157 5:62158595-62158617 GTCCCTAGGCTGCACACAGCAGG - Intergenic
991355781 5:65767445-65767467 GTCCTGAGGCTGCAGAGAGCAGG + Intronic
991472755 5:66986235-66986257 GTCCCTGGGGAGCACAGAGCTGG + Intronic
991735681 5:69629911-69629933 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991738806 5:69651195-69651217 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991759391 5:69905232-69905254 GTTCCTAGGCTGCACACAGCAGG + Intergenic
991787944 5:70212886-70212908 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991790381 5:70230936-70230958 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991812172 5:70485550-70485572 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991815130 5:70506027-70506049 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991818266 5:70527312-70527334 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991838619 5:70780298-70780320 GTTCCTAGGCTGCACACAGCAGG + Intergenic
991880390 5:71213250-71213272 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991882831 5:71231276-71231298 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991940839 5:71850529-71850551 GTCCTGAGGATGCACACAGCAGG + Intergenic
992141937 5:73807179-73807201 GCCCCAAGTCTGGACAGAGCAGG - Intronic
992835925 5:80641328-80641350 GTGCCAACCCTGCACTGAGCAGG + Intronic
992854888 5:80849679-80849701 GTCCCTATGCTACACACAGCGGG + Intronic
992954173 5:81890827-81890849 GTCCTAAGACTGCACATAGCAGG - Intergenic
993015690 5:82532235-82532257 GTCCCTAGGCTGCACACAGCAGG + Intergenic
993036939 5:82769158-82769180 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
993117492 5:83735320-83735342 GTCCCTAGGCTGCACACAGAAGG - Intergenic
993561630 5:89417707-89417729 GTCCCAAGGCTGCACACAGCAGG - Intergenic
993711591 5:91230549-91230571 GTCCCTAGTCTGTACACAGCAGG + Intergenic
993743337 5:91565526-91565548 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
993776967 5:92012044-92012066 GTCCCTAGGCTGCACACAGCAGG - Intergenic
993967205 5:94372600-94372622 GTCCCAGGGCTGCACAGAGGAGG + Intronic
994018953 5:95001972-95001994 GTCCCAAGGCTGCATAGAGCAGG - Intronic
994338747 5:98600788-98600810 GTCTCTAGGCTACACACAGCAGG - Intergenic
994421196 5:99527499-99527521 GTTCCTAGGCTGCACACAGCAGG + Intergenic
994485847 5:100386815-100386837 GTTCCTAGGCTGCACACAGCAGG - Intergenic
994549130 5:101208491-101208513 GTCCCAAGGCTGCACAGAATAGG - Intergenic
994590796 5:101769303-101769325 GTCCTGAGGCTGCACACAGCAGG + Intergenic
994696054 5:103074568-103074590 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
994749574 5:103721372-103721394 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
994808222 5:104479216-104479238 GTCTCAAGGCTGTACAGAGCAGG - Intergenic
995212028 5:109551468-109551490 GTCCCTAGGCTGCACACAGCAGG - Intergenic
995389717 5:111626990-111627012 GTCCAGAGGCTGCACACAGCAGG - Intergenic
995390951 5:111639865-111639887 GTTCTGAGGCTGCACAGAGAAGG - Intergenic
995393195 5:111661343-111661365 GTCCCTAGGCTGCACACAGCAGG + Intergenic
995591005 5:113699558-113699580 GTCCCCAGGCTGCACACAGGAGG + Intergenic
995597708 5:113765356-113765378 ATCCCCAGGCTGCACTGATCTGG - Intergenic
995630544 5:114127500-114127522 GTCGCTAGGCTGCACACAGCAGG + Intergenic
995667217 5:114555394-114555416 GTTCTGAGGCTACACAGAGCAGG + Intergenic
995702800 5:114955084-114955106 GTCCCTAGGCTGCATACAGCAGG - Intergenic
995774646 5:115712118-115712140 GTCCCGAGGCTGTACACAGCAGG + Intergenic
996122925 5:119691612-119691634 GTCCAGAGGCTGCACACAGCAGG + Intergenic
996246597 5:121271601-121271623 TTCCATAGGCTGCACACAGCTGG + Intergenic
996251022 5:121332025-121332047 GTCCTGAAGCTGCACACAGCAGG - Intergenic
996255859 5:121402533-121402555 ATCTCTAGGCTGCACATAGCAGG - Intergenic
996356476 5:122601070-122601092 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
996897618 5:128503960-128503982 GTCCCAAGGCTGCATAGAGCGGG - Intronic
997036865 5:130203013-130203035 GTACCTAGGCTGCACACAGCAGG + Intergenic
997052374 5:130398295-130398317 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
997102106 5:130980706-130980728 GTCTCAAGGCTACACAGAGCAGG + Intergenic
998759063 5:145411996-145412018 GTCCTGAGGCTGCACACAGCAGG + Intergenic
998980005 5:147691556-147691578 TACCCAAGGCTGCACAAAGCTGG + Intronic
998980533 5:147697582-147697604 GTCCCCAGGCTGCACACAGCAGG - Intronic
999564124 5:152838492-152838514 GTCCCACGGCAGCACTCAGCAGG + Intergenic
1000548878 5:162634346-162634368 GTCCTGAGACTGCACAGAGCAGG + Intergenic
1001433561 5:171682303-171682325 GTCCTGAGGTGGCACAGAGCAGG + Intergenic
1001435000 5:171693386-171693408 GCCCCAAGGCTGCAGGGAACAGG - Intergenic
1001470282 5:172006935-172006957 AGCCCAAGGCTGCCCAGACCGGG + Intergenic
1001994222 5:176142653-176142675 GTATTGAGGCTGCACAGAGCAGG - Intergenic
1002192859 5:177487847-177487869 CGCCCAAGGCTGCAAAGAGCAGG - Intronic
1002193404 5:177490269-177490291 TGCCCAAGGCAGCACAGACCTGG + Intronic
1002442656 5:179272465-179272487 GGACCATGGCAGCACAGAGCAGG + Intronic
1002471133 5:179436843-179436865 GTCACATGGCTGGACAGTGCTGG - Intergenic
1002516138 5:179760433-179760455 GGCCCCAGGCAGCACTGAGCAGG + Intronic
1003230062 6:4243704-4243726 GTCCTGAGACTACACAGAGCTGG + Intergenic
1003485156 6:6569171-6569193 GTCTCAAGGTTGCACAGGCCAGG + Intergenic
1003720123 6:8692636-8692658 GTTCCAAGGCTTCACAGAGCAGG - Intergenic
1003986647 6:11442497-11442519 GTCCCTAGGCTCCATAGAGCAGG - Intergenic
1004024518 6:11805834-11805856 GCACCAAGGCAGCACAGGGCAGG + Intronic
1004834542 6:19516140-19516162 ATCCCTAGGCTGCACAGAGCCGG - Intergenic
1005329064 6:24731677-24731699 GTTGCTAGGCTGCACAGAACAGG - Intergenic
1005548613 6:26894302-26894324 GTTCCTGGGCTGCACACAGCAGG - Intergenic
1005783391 6:29217479-29217501 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1005982965 6:30851586-30851608 GTCCCCAGGCTGCATAGAGCAGG - Intergenic
1005984161 6:30860118-30860140 GTCTCCAGGCTGCACACAGCAGG + Intergenic
1006084868 6:31588517-31588539 GGCCCAGGGCTCCTCAGAGCAGG + Exonic
1007223445 6:40296534-40296556 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1007506141 6:42336933-42336955 GAGCCAAGGCTCCATAGAGCCGG - Intronic
1007555912 6:42766239-42766261 GTCTCAAGTTTGCCCAGAGCTGG + Intronic
1008332765 6:50262687-50262709 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1008337515 6:50324860-50324882 GTCCCTAGGCTACACACAGCAGG + Intergenic
1009019369 6:57935409-57935431 GTTCCTAGGCTGCACACAGCAGG - Intergenic
1009051562 6:58282735-58282757 GTCCCGAGGCTGCATAGAGCAGG - Intergenic
1009242430 6:61198631-61198653 GTCCTGATGCTGCACAGAACAGG - Intergenic
1009383593 6:63062985-63063007 GTCTTGAGGGTGCACAGAGCAGG - Intergenic
1009501560 6:64420269-64420291 TTCCCTAGGCTGCATACAGCCGG + Intronic
1009554789 6:65148964-65148986 GTCCTGAGGCTGCACGGAGTGGG + Intronic
1009620012 6:66063600-66063622 ATCTCTAGGCTGCACACAGCAGG - Intergenic
1009631733 6:66208998-66209020 GTTCCTAGGCTGCACACAGCAGG + Intergenic
1009699715 6:67160775-67160797 TTTCCAAGGCTGCACAGAGCAGG - Intergenic
1009825033 6:68856901-68856923 GTCTGCAGTCTGCACAGAGCAGG - Intronic
1009982436 6:70741989-70742011 GTCCCTAGGCTGCACACAGCAGG + Intronic
1010055101 6:71556072-71556094 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1010316074 6:74452113-74452135 GTACCAAGAGGGCACAGAGCTGG + Intergenic
1010458229 6:76083067-76083089 GTTCTGAGGCTGCACAGAGCAGG + Intergenic
1010594612 6:77748489-77748511 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1010605924 6:77889775-77889797 GTTCCAAGGCTGCATAAAGCAGG - Intronic
1010610751 6:77951793-77951815 CTCCCATGACTGTACAGAGCAGG - Intergenic
1010631838 6:78207707-78207729 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1010810440 6:80293463-80293485 GTCCCTAGACTGCACACAGCAGG + Intronic
1010819401 6:80395816-80395838 GTTCTAAGGCTGCACACAGCAGG - Intergenic
1010835806 6:80586462-80586484 GTCCCTAAGCTGCACACAGTAGG - Intergenic
1010900524 6:81422626-81422648 GTCCCAAGGCTGTACAGAGCAGG - Intergenic
1010906800 6:81501247-81501269 GTCCTGAGGCTGCATAGAGCAGG - Intronic
1010909571 6:81536738-81536760 GTCCCTAGGCTGCACTGAGCAGG + Intronic
1010956693 6:82098372-82098394 GCCCCAAGCCTGCTCAGAGTAGG - Intergenic
1011031703 6:82931022-82931044 ATCCCTAGGCTGCACATAGCAGG - Intronic
1011041124 6:83031770-83031792 GTCCCTAGGCTGCACACAGCAGG - Intronic
1011264107 6:85497535-85497557 GTCCCTAGGCTGGACACAGCAGG + Intergenic
1011347676 6:86389689-86389711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1011355149 6:86466168-86466190 GTCCCTAGGCTGCACACAATAGG - Intergenic
1011439194 6:87369502-87369524 GGCCCTAGGCTGCACAAAGCAGG + Intronic
1011738290 6:90334110-90334132 GTCCCCAAGCTGCACACAGCAGG + Intergenic
1011784203 6:90826206-90826228 GTCCCCAGGGTGCACACAGGAGG - Intergenic
1011845031 6:91552496-91552518 GTCCAGAGGCTGCATAGAGCAGG + Intergenic
1011876246 6:91965863-91965885 GTCTCAAGGATGCACAAAGCAGG - Intergenic
1011916380 6:92511446-92511468 GTCCCAAGACTGCACACACTGGG - Intergenic
1011933024 6:92737830-92737852 GTCCTGAGGGTGCATAGAGCAGG - Intergenic
1011981718 6:93386896-93386918 GTCCCTAGGCTGCACACAGTAGG + Intronic
1012029192 6:94036889-94036911 GCCCCAAGGCTGCATAGAGTAGG - Intergenic
1012125961 6:95428443-95428465 GTTCCTAGGCTGCACACAGGAGG - Intergenic
1012179905 6:96139817-96139839 GTCCTGAGGCTGCATAGAGTGGG + Intronic
1012202560 6:96424348-96424370 GTCACTAGGCTGCACATTGCAGG + Intergenic
1012380652 6:98615826-98615848 GCCCCTAGGCTGCACAAAGCAGG + Intergenic
1012478235 6:99637785-99637807 ATCCTGAGGCTGCATAGAGCAGG + Intergenic
1012514163 6:100039372-100039394 GTCACGAGGCTGCATATAGCAGG - Intergenic
1012690787 6:102308354-102308376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1012706529 6:102538764-102538786 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1012788207 6:103658601-103658623 GTCCCTAGGCTGCACACAGAAGG + Intergenic
1013213704 6:108008512-108008534 GTTCTGAGGCTGCATAGAGCAGG + Intergenic
1013549223 6:111190765-111190787 GTCCCTAAGCTGCACACAGCAGG + Intronic
1013558797 6:111283827-111283849 GTCCCTAGACTGCACACAGCAGG + Intergenic
1014067708 6:117146099-117146121 GTCCCTAGGCTGCACACAGAAGG + Intergenic
1014073151 6:117206021-117206043 GTCCCCAGGCTGCACACACAGGG + Intergenic
1014407442 6:121068968-121068990 ATCCCAAGGCTGCGCACAGCAGG - Intergenic
1014475980 6:121872528-121872550 GTTCCTAGGCTGCACACAGCAGG + Intergenic
1014562998 6:122913765-122913787 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1014649538 6:124018228-124018250 GTCCCTAGGCTGCACAAAGTAGG + Intronic
1014883095 6:126746746-126746768 GTCCTGACGCTGCACAGAGCAGG + Intergenic
1014951177 6:127558055-127558077 GTCCCTAGGCTGCACACAGCAGG - Intronic
1015013212 6:128376436-128376458 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1015045209 6:128768353-128768375 GTCTCCAGGCTGTACACAGCAGG + Intergenic
1015239579 6:131008177-131008199 GTCCAGAGGCTGCACAGAGCAGG - Intronic
1015713143 6:136163412-136163434 GTCCCAAGGCTGCACAGAGCTGG + Intronic
1015868472 6:137752017-137752039 GTCCCCTGCCTGCACAGACCTGG - Intergenic
1015901682 6:138074575-138074597 GTCACTAGACTGCACATAGCAGG - Intergenic
1015995744 6:138994015-138994037 GTCCTTACGCTGCACACAGCAGG - Intergenic
1016175206 6:141071517-141071539 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1016295962 6:142573973-142573995 GTCCCGAGGCTGCATAAAGCAGG - Intergenic
1016537602 6:145126210-145126232 GTCCCTAGGCTACACAGAGCAGG - Intergenic
1016540556 6:145159457-145159479 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1016669080 6:146680299-146680321 GCCACAAGGATGGACAGAGCAGG + Intronic
1016682365 6:146845429-146845451 GTCCCCAGGCTGCACATAGCAGG + Intergenic
1016790247 6:148060269-148060291 GTCCTAAGGCTGCACACAGCAGG + Intergenic
1016987868 6:149908702-149908724 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1017407895 6:154139590-154139612 GTCCCTGGGCTGCACAGGTCAGG - Intronic
1017763668 6:157590383-157590405 GTCCATAGGCTGCACACAGCAGG - Intronic
1018075366 6:160207584-160207606 GTCCCTAAGCTGCACAGAGCAGG + Intronic
1018086318 6:160303962-160303984 GTCCCAAGGCTGCACATAGCAGG + Intergenic
1018477748 6:164159735-164159757 GTCCTGAGGCTGCACACAGTAGG + Intergenic
1018566889 6:165163703-165163725 GCCCTAAGGCTGCATAGAGCAGG + Intergenic
1018585155 6:165349725-165349747 GTCCCAAGGCTGCATAGAGCAGG - Intronic
1019081595 6:169435004-169435026 GTCCATAAGCTGCACACAGCAGG - Intergenic
1019150902 6:170005001-170005023 GTCCTGAGGCAGCACAGAGCAGG + Intergenic
1019697184 7:2452402-2452424 GTCCCAGGGCTGTGAAGAGCTGG + Intergenic
1020007526 7:4790413-4790435 GTCATAGGTCTGCACAGAGCAGG + Intronic
1020100770 7:5393278-5393300 GTGCCCAGCCTGCACAGAGTGGG - Intronic
1020407711 7:7855559-7855581 ATCCCAAGGCTGCACACAGCAGG + Intronic
1020581749 7:10011602-10011624 GTTCTGAGGCTGCACAGACCAGG - Intergenic
1020611326 7:10401452-10401474 GTCTCAAGGCTGCATAGCACAGG + Intergenic
1020729659 7:11865885-11865907 GTCTTGAGGCTGCACACAGCAGG - Intergenic
1020958762 7:14776472-14776494 GTCCCTAGGCTGCACACAGCAGG - Intronic
1021001765 7:15340520-15340542 GTGCTGAGGCTGCACACAGCAGG - Intronic
1021323511 7:19239990-19240012 GTCCTGAGGCTGCACATAGCAGG + Intergenic
1021326347 7:19273708-19273730 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1021340441 7:19457443-19457465 GTCCCACAGCTGCCCATAGCAGG + Intergenic
1021573332 7:22086233-22086255 GTCCCTAGGTTGTACACAGCAGG + Intergenic
1021750548 7:23795195-23795217 GTCTGAAGGCTGCACACAGCAGG - Intronic
1021754003 7:23833629-23833651 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1021762236 7:23913271-23913293 GTCCCAAGGCCACATAGAGAAGG - Intergenic
1021798801 7:24284349-24284371 GCCCCAGGGCTCCACAGAGCGGG - Intronic
1021846480 7:24768062-24768084 GTCCCAAGGCTGCCCCCAGCTGG + Intergenic
1022405542 7:30086471-30086493 GTCCAGAGGGTGAACAGAGCTGG + Intronic
1022512919 7:30952635-30952657 ATCTTGAGGCTGCACAGAGCAGG + Intronic
1022607824 7:31833974-31833996 GTCCCTAGGCTGCACACAGCAGG - Intronic
1023208395 7:37776149-37776171 TTCCCTAGGCTGCACACAGCAGG - Intronic
1023236833 7:38098992-38099014 GCCCTGAGGCTGCACAGAGCAGG - Intergenic
1023804076 7:43858931-43858953 GTCCCTATGCTGCACATAGCAGG - Intergenic
1024383553 7:48725635-48725657 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1024384723 7:48738567-48738589 GTCCCAAGACTGCACAGAGCAGG - Intergenic
1024415966 7:49107647-49107669 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1024487142 7:49931850-49931872 GGCCCTAGGCTGCAGAGAGCAGG - Intronic
1024667241 7:51559232-51559254 GTCCCAAGGATGCACAGAGCAGG - Intergenic
1024721222 7:52139232-52139254 GTCCCTGGGCTGCACATAACAGG + Intergenic
1024792752 7:52985350-52985372 GTCCCTAGGCTGCACAAAGCAGG - Intergenic
1024865849 7:53904477-53904499 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1024912130 7:54458010-54458032 GTCCCAAGGCTTCACAGAACAGG - Intergenic
1024948198 7:54833169-54833191 GTCCCCTGGCTGCACAGGGCGGG - Intergenic
1025038538 7:55619122-55619144 GTCCCAAGGCTGCATGGAGCAGG - Intergenic
1025276861 7:57589631-57589653 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1026831740 7:73614552-73614574 GATCAAAGGCTGCACTGAGCTGG - Intronic
1026881968 7:73912465-73912487 GTCCCAAAGTTGAACAGAGGCGG + Intergenic
1026946402 7:74319041-74319063 TTCACAAGGCTGCACTGGGCAGG - Intronic
1027279225 7:76593585-76593607 GTTGCTAGGCTGCACACAGCGGG + Intergenic
1027977565 7:85178862-85178884 AGTCCAAGGCTGCACACAGCAGG - Intronic
1027993577 7:85395428-85395450 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1028023673 7:85808947-85808969 GTCCCTAAGCTGCACAGAGCAGG - Intergenic
1028032399 7:85932765-85932787 GTCCTGAGGCAGCACAGAGTGGG - Intergenic
1028048363 7:86152136-86152158 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1028054208 7:86222971-86222993 GTCCCTAGGCTGCACACAGTAGG + Intergenic
1028143767 7:87299106-87299128 GTCCCTAGGCTGCACAAAGCAGG + Intergenic
1028708096 7:93874395-93874417 GTCCCTAGGCTGCACACAGCAGG - Intronic
1028957755 7:96713027-96713049 GTCCTGAGGCTGCATACAGCAGG - Intergenic
1029311131 7:99665984-99666006 GTCCCAAGTCTGAACAGGACAGG + Intronic
1030108830 7:106009326-106009348 GTCCCAAGGCTGCATAAGGGCGG + Intronic
1030382398 7:108827334-108827356 ATCACATGGCTGCACAGAGAAGG - Intergenic
1030411894 7:109191269-109191291 CTGCAAAGGCTGCACAGATCTGG - Intergenic
1030415455 7:109238065-109238087 GTCCCAAGGCTGCACACAACAGG - Intergenic
1030527676 7:110673300-110673322 GTCCTGAGGCTGCTTAGAGCAGG + Intronic
1030722415 7:112885147-112885169 GTCTCAAGGCTGCACAGGGCAGG + Intronic
1030851079 7:114487335-114487357 GTCCCTAGGCTGCACACAGCAGG + Intronic
1031170875 7:118290757-118290779 GTCCCGAGGCTGCATAGAGCAGG - Intergenic
1031193627 7:118586644-118586666 GTCCCTAGGCTGTACTCAGCAGG - Intergenic
1031194176 7:118591130-118591152 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1031230195 7:119096046-119096068 GTCCCTAGGCTGCATACAGCAGG + Intergenic
1031238653 7:119210760-119210782 TTCTCCAGGCTGCACACAGCAGG - Intergenic
1031287303 7:119886145-119886167 CTCCCTAGGCTGCACACAGCAGG + Intergenic
1031330420 7:120457114-120457136 GTCCCAAGGCTGCACACATTAGG + Intronic
1031473134 7:122191261-122191283 GTCCCTAGGCTGCACATAGTGGG - Intergenic
1031545763 7:123049995-123050017 GTCCCTAGGCTACAGACAGCAGG + Intergenic
1031645555 7:124221434-124221456 CTTCCTAGGCTGCACAGAGCAGG - Intergenic
1031702413 7:124942605-124942627 GTCCCCAGGCTGCATACAGCAGG - Intergenic
1031722424 7:125193583-125193605 GTCCTGAGGCTGCACAGATCAGG - Intergenic
1031769795 7:125829308-125829330 GTCCCTACGCTGCACACAGTAGG + Intergenic
1032423316 7:131800726-131800748 GCCCACAGGCTGCAGAGAGCAGG + Intergenic
1032576328 7:133059062-133059084 GTCCCTAGACTTCAAAGAGCAGG + Intronic
1033256158 7:139803666-139803688 GTTCCTAGGCTGCACACAGTGGG - Intronic
1033517942 7:142128554-142128576 GTCCCTAGGCTGCACAGAGCAGG - Intronic
1033777525 7:144629276-144629298 ATCCCGAGGCTGCACAGAGCAGG - Intronic
1033953305 7:146812840-146812862 CTCCCGAGGCTGCACAGAGCAGG - Intronic
1034040766 7:147874520-147874542 GTCCCTAGGCTGCACACAGCAGG + Intronic
1034209324 7:149349148-149349170 GTCCCAAGGCTGCATAAAGCAGG + Intergenic
1034510729 7:151532441-151532463 GTCTTGAGGCTGCACAGAGCAGG + Intergenic
1034718391 7:153264592-153264614 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1034739654 7:153462320-153462342 GTCTCTAGGTTGCACACAGCAGG - Intergenic
1034742878 7:153495014-153495036 GTCCTGAGGCTGCATAGAGCAGG - Intergenic
1034751855 7:153576325-153576347 GTCCCTAGGCTGCACACAACAGG - Intergenic
1034959844 7:155358369-155358391 GTCCCAGGGAGGCACAGAGGGGG - Exonic
1035149928 7:156861364-156861386 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1035752512 8:2006585-2006607 GCCCGAAGGCTGCACAGTCCAGG - Exonic
1036106501 8:5846278-5846300 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1037108374 8:15137541-15137563 GTCCCTAGGCTGCACACAGCAGG - Intronic
1037884190 8:22587824-22587846 TGGCCAAGGCTGCAGAGAGCTGG + Intronic
1037934522 8:22906252-22906274 CTCCCAAGGCTGGACAGAGGAGG - Intronic
1037979138 8:23238186-23238208 GTCCTAAGGCTGCAAACTGCAGG + Intergenic
1038006451 8:23434560-23434582 GCCCCAAGGCTGCCCACAGAGGG - Intronic
1038478835 8:27887461-27887483 GTGCCATTCCTGCACAGAGCTGG - Intronic
1038880486 8:31605600-31605622 GTCAATAGGCTGCACACAGCAGG + Intergenic
1039082364 8:33745550-33745572 GTCGGAAGGCAGCATAGAGCAGG + Intergenic
1039309201 8:36297557-36297579 GTCCCAAGACTGCACAGAGTGGG - Intergenic
1039511345 8:38094590-38094612 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1039809877 8:41037171-41037193 GTCCCAAGGCTGGGCACAGTGGG - Intergenic
1040478608 8:47803339-47803361 GTCCCAGGGCTGCTCTGAGCAGG - Exonic
1040644978 8:49387822-49387844 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1040741318 8:50579567-50579589 GCCCCAGGGATGCACATAGCAGG - Intronic
1041437982 8:57863013-57863035 GTTCCTACGCTGCACACAGCAGG - Intergenic
1041497539 8:58503351-58503373 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1041849836 8:62378543-62378565 GTCCCAAGACTGCACACAGCAGG - Intronic
1042080630 8:65047136-65047158 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1042197039 8:66239628-66239650 GTCCAGTGGCTGCACAGAGTGGG - Intergenic
1042407579 8:68422991-68423013 GTCCTGAGGCAGCACAGAGCAGG + Intronic
1042529041 8:69796028-69796050 GTCCCAAGATTGCACAGGGCAGG + Intronic
1042601292 8:70502262-70502284 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1042622088 8:70717583-70717605 GTCCTGAGGCTGCATAGAGCAGG + Intronic
1042827150 8:72990992-72991014 GTCCGCAGGCTGCACAGAGCAGG - Intergenic
1043087225 8:75849690-75849712 GTGCCAAGGCAGCACGGGGCTGG + Intergenic
1043308186 8:78823356-78823378 GTCCCTAGGCTGCACATAACAGG - Intergenic
1043370307 8:79583737-79583759 GTTCCAAGGCTGCACAGAGCAGG - Intergenic
1043426080 8:80150088-80150110 GTCCCTAGGCTGCACACAGCAGG - Intronic
1043492524 8:80763525-80763547 GTGCCTAGGCTGCACACAGCAGG + Intronic
1043518529 8:81019441-81019463 GTCCCGGGGCTGCACAGAACAGG - Intronic
1043940473 8:86190395-86190417 GTTCCAAGGCTGCATAGATTGGG + Intergenic
1044017187 8:87058698-87058720 GTCCCAAGGCTGCACGCAGTAGG + Intronic
1044051794 8:87515047-87515069 GTCTCAAGGCTGCACAGAGCAGG - Intronic
1044127042 8:88471736-88471758 GTACCGAGACTGCACACAGCAGG + Intergenic
1044205759 8:89490621-89490643 GTCCCTTGGCTGAACACAGCAGG - Intergenic
1044220466 8:89663614-89663636 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1044282643 8:90374802-90374824 GTCCCTAGTCTGCACACAGCAGG + Intergenic
1044324864 8:90847822-90847844 GTCCGTAGGCTGCACACAGCAGG + Intronic
1044395675 8:91708197-91708219 GTCCTGAGGCTGCATAGAGCAGG - Intergenic
1045048629 8:98302730-98302752 GTACCAAGGCTGCACAGTCCTGG + Intergenic
1045207387 8:100056533-100056555 GTCCCTAGGCTGTACACAGCAGG - Intronic
1045422181 8:102027030-102027052 GTCCCAAGGCTGCACAGGGCAGG + Intronic
1045499149 8:102731830-102731852 GTCCTAGGGCTGCAAAGAGGAGG - Intergenic
1045597225 8:103670239-103670261 GACCCTAGGCTGCACGCAGCAGG + Intronic
1045785724 8:105918444-105918466 GTCTCAAGGCTGCACACAGCAGG - Intergenic
1045884445 8:107079011-107079033 GTCCCGAGGCTGCACATAGCAGG + Intergenic
1045888551 8:107127552-107127574 GTCCCAAGGCCGCATAGAGCAGG + Intergenic
1046107410 8:109682825-109682847 GTCCTGAGGCTGAACACAGCAGG - Intronic
1046146805 8:110171659-110171681 GTCCCTAGGCTGCACACACCAGG - Intergenic
1046170352 8:110497763-110497785 GTCCCAAGGCTTCACACAGCAGG - Intergenic
1046175582 8:110571160-110571182 GTCCCTAGGCTGCATAAAGCAGG + Intergenic
1046264581 8:111814414-111814436 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1046264587 8:111814445-111814467 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1046300203 8:112276922-112276944 GTTCCTAGACTGCACACAGCAGG + Intronic
1046309425 8:112415214-112415236 GTCCTGAGGCTGCACAGAGCAGG - Intronic
1046311269 8:112440830-112440852 GCCCCAAGGCTGCATATAGTAGG + Intronic
1046506780 8:115146828-115146850 GTCCTTAGCCTGCACAGAGCAGG + Intergenic
1046600863 8:116315489-116315511 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1046607536 8:116388331-116388353 ATCCCAAGGCTGCACACAGCAGG - Intergenic
1046782113 8:118226751-118226773 GTTCCATGGGTGCACAGAGAAGG + Intronic
1046917373 8:119691951-119691973 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1047586882 8:126282724-126282746 GTCCCTAGGCTGCACACAGTAGG - Intergenic
1047675540 8:127197509-127197531 GTGCTGAGGCTGCACAGAGGAGG - Intergenic
1047795270 8:128248770-128248792 GTCCAAAGGCTGCCAAGGGCTGG - Intergenic
1047869921 8:129071360-129071382 GTCCTGAGGCTGCACAAAGCAGG - Intergenic
1047918078 8:129604044-129604066 GCCCCAAGGCTGCACAGAGCAGG + Intergenic
1047924477 8:129669482-129669504 GTCCCTGGGCTGCACACAGCAGG - Intergenic
1048023156 8:130559347-130559369 GTCCCAGGCCTGCACATAGAAGG - Intergenic
1048107542 8:131427756-131427778 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1048116687 8:131531763-131531785 GTCCCTAGGCTGCACACAGTAGG - Intergenic
1048658555 8:136571240-136571262 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1048660877 8:136599841-136599863 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1048669057 8:136695916-136695938 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1048729218 8:137418977-137418999 GTCCCAAGGCTGCACATGCAGGG + Intergenic
1048844988 8:138597600-138597622 GTCCTCAGGCTGTACAGAGCTGG + Intronic
1049165320 8:141122054-141122076 TCCCCAGAGCTGCACAGAGCAGG - Intronic
1049414789 8:142490236-142490258 GTCTCACAGCTGCTCAGAGCAGG + Intronic
1050086533 9:1972090-1972112 GTCCCTAAACTGCACACAGCAGG - Intergenic
1050113921 9:2243299-2243321 GTCCCAAGTCTACAGTGAGCTGG - Intergenic
1050849276 9:10263889-10263911 GTCCCTAGGCAGCAAACAGCAGG - Intronic
1050897306 9:10899639-10899661 GTTCCTAGGTTGCACAGAGCAGG + Intergenic
1051285615 9:15492912-15492934 GTCCCAACGCTGCACGCAGCAGG + Intronic
1051984274 9:23063842-23063864 GTCCAGAGGCTGCATAGAGCAGG + Intergenic
1052053988 9:23882856-23882878 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1052093473 9:24357303-24357325 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1052124236 9:24755780-24755802 GTTCCTAGGCTACACAAAGCAGG - Intergenic
1052250271 9:26390065-26390087 GTCCCAAGGCTACATCAAGCAGG - Intergenic
1052272015 9:26636948-26636970 GTCCAAAGGCTCCACATTGCAGG + Intergenic
1052294540 9:26882352-26882374 GTCCCTAGGGTACACATAGCAGG - Intronic
1052468829 9:28866530-28866552 GTTCTAAGGCTGCAGAGAGGAGG + Intergenic
1052557159 9:30032289-30032311 GTCCCTAGGCTGCACAGAGTAGG + Intergenic
1052625018 9:30963189-30963211 GTCCCAAGACTGCATAGAGTAGG + Intergenic
1052625986 9:30978253-30978275 GTCCCTAGGCTGCACAAAGCAGG - Intergenic
1052846436 9:33340396-33340418 GTCCCGAGGCTGCATGCAGCAGG + Intronic
1052879071 9:33589442-33589464 GTCCTGAGGCTACACACAGCAGG - Intergenic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1053196016 9:36119548-36119570 ATTCCAAGTCTGCACAGAACAGG + Intronic
1053384203 9:37673855-37673877 GTCCCTAGGCTGCACACAGCAGG + Intronic
1053496905 9:38554777-38554799 GTCCTGAGGCTACACACAGCAGG + Intronic
1053571919 9:39318667-39318689 GTCTCAAAGCTGCATAGAACAGG - Intergenic
1053665301 9:40313429-40313451 GTCCTGAGGCTGCACATAGAGGG - Intronic
1053675361 9:40420534-40420556 GTCCCTAGACTGCACATAGAGGG - Intergenic
1053882686 9:42611679-42611701 GTCTCAAAGCTGCACAGAACAGG + Intergenic
1053889983 9:42682623-42682645 GTCTCAAAGCTGCACAGAACAGG - Intergenic
1053893394 9:42718800-42718822 GTCCCAAGGTGGCACACAGCAGG - Intergenic
1053914889 9:42938476-42938498 GTCCTGAGGCTGCACATAGAGGG - Intergenic
1054093473 9:60877378-60877400 GTCTCAAAGCTGCATAGAACAGG - Intergenic
1054114956 9:61153298-61153320 GTCTCAAAGCTGCATAGAACAGG - Intergenic
1054125226 9:61300344-61300366 GTCTCAAAGCTGCACAGAACAGG + Intergenic
1054221713 9:62419147-62419169 GTCTCAAAGCTGCACAGAACAGG + Intergenic
1054229001 9:62490026-62490048 GTCTCAAAGCTGCACAGAACAGG - Intergenic
1054288633 9:63259060-63259082 GTCCCTAGACTGCACATAGAGGG - Intergenic
1054376455 9:64453459-64453481 GTCCTGAGGCTGCACATAGAGGG - Intergenic
1054386459 9:64560597-64560619 GTCCCTAGACTGCACATAGAGGG - Intergenic
1054509261 9:65955758-65955780 GTCCCTAGACTGCACATAGAGGG + Intergenic
1054519314 9:66062855-66062877 GTCCTGAGGCTGCACATAGAGGG + Intergenic
1054592800 9:67029236-67029258 GTCTCAAAGCTGCATAGAACAGG + Intergenic
1055223800 9:73969886-73969908 GTCCCATGACTGAATAGAGCAGG - Intergenic
1055701250 9:78948013-78948035 GTCCTGAGGCTGCACACAGGAGG - Intergenic
1055774397 9:79752203-79752225 GTCCCATTGCTGTATAGAGCAGG + Intergenic
1055848309 9:80594300-80594322 GTCCCAAGCCTGCATAGAGCAGG - Intergenic
1055976016 9:81955839-81955861 GTCCCTAGGCTTCACAAAGCAGG + Intergenic
1056325503 9:85475121-85475143 GTCCCAAGGCTGCATAGGTCAGG - Intergenic
1056825800 9:89875601-89875623 GTCCCAAGGGTGCTGAGGGCAGG + Intergenic
1057161403 9:92890912-92890934 GTCCTGAGGATGCACACAGCAGG + Intergenic
1057285373 9:93749267-93749289 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1057510879 9:95678661-95678683 GAGCCAAGGCAGCAGAGAGCTGG + Intergenic
1057675954 9:97136118-97136140 GTCCTGAGGCTGCACATAGAGGG + Intergenic
1057676815 9:97142334-97142356 GTCCTGAGGCTGCACACTGCAGG + Intergenic
1057732466 9:97622179-97622201 GTCCCTAGACTGCCCACAGCAGG - Intronic
1058086493 9:100753388-100753410 GTCCCTAGGCTGTACACAGCGGG + Intergenic
1058149889 9:101452561-101452583 GTCCCTAGGCTGCACAGGGCAGG - Intergenic
1058210488 9:102161695-102161717 GTCCCAAGGTTGCAAACAGCAGG + Intergenic
1058221948 9:102313837-102313859 GTCCCTAGGCTAAACATAGCAGG - Intergenic
1058279710 9:103098805-103098827 GTCTCTAAACTGCACAGAGCAGG + Intergenic
1058307769 9:103464276-103464298 GTCCCTAGGCTGCACACAGGAGG + Intergenic
1058332817 9:103785389-103785411 CTCCCAAGGCTGCAGAGAAAAGG + Intergenic
1058393684 9:104525160-104525182 GTCTTTAGGCTGCACACAGCAGG + Intergenic
1058401518 9:104625118-104625140 GTCCCTAGGCTGCACCCAGCAGG - Intergenic
1058618522 9:106860871-106860893 CTCCCAAAGCCGCACAAAGCCGG + Intergenic
1058809989 9:108630266-108630288 GTCCTTAGGCTGCACAGACCAGG - Intergenic
1059023067 9:110597200-110597222 GTCCCTAGACTGCACAGAGCAGG + Intergenic
1059045444 9:110861593-110861615 GTCCCTAGGCTGCACACAGCTGG - Intergenic
1059069528 9:111120659-111120681 GTCCCGAGGCTGCACACAGCAGG + Intergenic
1059082618 9:111266174-111266196 ATCCCTAGGCTGCACACAGCAGG + Intergenic
1059362818 9:113759089-113759111 GTCTCAAGGCTGGGCTGAGCAGG - Intergenic
1059628285 9:116091486-116091508 GTCCCTAGGATGTACATAGCAGG - Intergenic
1060835978 9:126755483-126755505 GGCCCAGGGCCCCACAGAGCAGG - Intergenic
1061069077 9:128297592-128297614 TTCCCAAGGAAGCACAGAGAAGG + Intergenic
1061563517 9:131421992-131422014 GTCACAAGGCTGCCGAGTGCAGG - Intronic
1062250519 9:135591627-135591649 GCCCCAGTGCTGCCCAGAGCGGG + Intergenic
1062444796 9:136589090-136589112 GTCCCAGGGCAGCTCTGAGCAGG + Intergenic
1062634814 9:137485148-137485170 GTCCCCAGGCCCCACACAGCAGG + Intronic
1203627979 Un_KI270750v1:42890-42912 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1185482709 X:459683-459705 GTCCCAAGGCAGGCCAGGGCTGG - Intergenic
1185769762 X:2756942-2756964 GTACCAAGACGGCACTGAGCTGG - Intronic
1185797705 X:2981197-2981219 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1186620465 X:11235346-11235368 GTCCTAAGGCTGCATAGAGCCGG + Intronic
1186679340 X:11855214-11855236 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1187097390 X:16162560-16162582 GTCCCTGGGCTGCACACAGCAGG + Intergenic
1187133623 X:16526202-16526224 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1187894452 X:23967155-23967177 GTCCCTAGGCTGCACACGGCAGG + Intergenic
1188041677 X:25376363-25376385 GTCCCTAGGAGGCACACAGCAGG - Intergenic
1188062518 X:25618396-25618418 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1188158892 X:26776291-26776313 GTCTGGAGGCTGCACAGAGCAGG - Intergenic
1188169886 X:26911580-26911602 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1188187331 X:27130977-27130999 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1188221531 X:27546782-27546804 GCCCTGAGGCTACACAGAGCAGG + Intergenic
1188325555 X:28797120-28797142 GTCCCTAGACTGCACACAGCAGG + Intronic
1188457118 X:30379696-30379718 GTCCAAAGACTGCACACACCAGG - Intergenic
1188514888 X:30974632-30974654 GACACAAAGATGCACAGAGCTGG + Intronic
1188624303 X:32265179-32265201 GTCCCTAGGCTGCACATAGCAGG - Intronic
1188731197 X:33648165-33648187 GTTCCTAGGCTGCACATAACAGG + Intergenic
1188748249 X:33873491-33873513 GTCACTAGGCTGCACACAGCAGG + Intergenic
1188749228 X:33885033-33885055 GTCCCTAGGCTGCGCACAGCTGG - Intergenic
1188753853 X:33936274-33936296 GTCCCTAGGCTGCACACAAAAGG + Intergenic
1188755190 X:33953195-33953217 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1188781777 X:34294845-34294867 GTCCCAAGGCTGCACACAGCGGG - Intergenic
1188857041 X:35209313-35209335 GTCCTTAGGCTCCACACAGCAGG + Intergenic
1188865150 X:35305283-35305305 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1188889669 X:35594934-35594956 GTCCATAGGCTGCACACAGCAGG - Intergenic
1188926494 X:36050848-36050870 ATCCCTAGGCTGCACACAGCAGG - Intronic
1189071329 X:37866815-37866837 GTACCAAGGCTGCACAGAGCAGG + Intronic
1189176586 X:38963636-38963658 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1189344744 X:40232468-40232490 GTCCCTCGGGTACACAGAGCAGG + Intergenic
1189377164 X:40475012-40475034 GTCGCCAGGCTGGACAGAGCAGG - Intergenic
1189788691 X:44583183-44583205 GTCCCAAGACTGCACACAGTAGG - Intergenic
1189815751 X:44822886-44822908 GTCCTGAGGCTACATAGAGCAGG - Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1189877926 X:45455966-45455988 GTCCTGAGGCTGCGTAGAGCAGG - Intergenic
1190000788 X:46684757-46684779 TTGCCAAGGCTGAGCAGAGCAGG - Intronic
1190269695 X:48853035-48853057 GTCCCTAGGCTGCACACAGGAGG + Intergenic
1190950585 X:55139539-55139561 GTTCTGAGGCTGCACAGAGCAGG - Intronic
1191095049 X:56665088-56665110 GTCCCTGGGCTGCACACAGTGGG - Intergenic
1191598477 X:62974488-62974510 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1191602722 X:63027202-63027224 GTCCAAAGAATGCACAAAGCAGG + Intergenic
1191606931 X:63072302-63072324 GTCCCTGGGCTGCACACTGCAGG + Intergenic
1191680014 X:63831223-63831245 GTCCCAAGGCTGTACAGAGCAGG - Intergenic
1191688169 X:63913942-63913964 GTCCCTAGGCTGCAGACAGCAGG - Intergenic
1191776860 X:64823905-64823927 GTCCTTTGGCTGCAAAGAGCAGG - Intergenic
1191986681 X:66988440-66988462 GTCCCTAGGCTGCACACAACAGG + Intergenic
1192676603 X:73203072-73203094 GTCCCTAGGCTGTACAGAACAGG + Intergenic
1192713609 X:73616778-73616800 GTCCCTAGGCTGCACACAGCAGG + Intronic
1192742403 X:73905976-73905998 GTCTCTAGACTGCACACAGCAGG - Intergenic
1192967614 X:76195784-76195806 GTCCCTATGCTGAACATAGCAGG + Intergenic
1193008103 X:76643800-76643822 GTTCCAAGGCTGCATAGAATGGG - Intergenic
1193043159 X:77024813-77024835 GTCCTAAGGCTGTATAGAGCAGG + Intergenic
1193167698 X:78301084-78301106 GTCTCTAGGCTTCACAAAGCAGG + Intronic
1193195881 X:78631349-78631371 GTCCAAAGGCTGAACACAGCAGG - Intergenic
1193210485 X:78801729-78801751 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193246579 X:79237151-79237173 GTTCCAAGGCTGCAGAGAGCAGG + Intergenic
1193271759 X:79537232-79537254 GTCCCCAGGCTACACAGAGCAGG - Intergenic
1193273311 X:79554693-79554715 GTCCCTAGGATGCATACAGCAGG - Intergenic
1193283508 X:79684178-79684200 GTCCCTAGGCTACACACAACAGG - Intergenic
1193320374 X:80114740-80114762 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193346717 X:80412231-80412253 GTCACTTGGCTGCACACAGCAGG + Intronic
1193370697 X:80694071-80694093 GTTCCAAGTGTGCGCAGAGCAGG - Intronic
1193506256 X:82348264-82348286 GTCACAAGGCTGCATAGAGCAGG + Intergenic
1193543029 X:82794773-82794795 CTCCCTAGGCTGCACAGAGCAGG - Intergenic
1193682664 X:84541304-84541326 GCCCTCAGGCTGCACACAGCAGG - Intergenic
1193807978 X:86016437-86016459 GCCCCTAGGCTGCATACAGCTGG - Intronic
1193816231 X:86107645-86107667 GTCCCAAGGCTGCACACAGCTGG + Intergenic
1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG + Intronic
1193865093 X:86721051-86721073 GTCCCTAGGCTGCACACAGCAGG + Intronic
1193887980 X:87006696-87006718 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1193890946 X:87045627-87045649 GTCCCTAGGCTGCATACAGCAGG - Intergenic
1193950263 X:87788515-87788537 GTCCCTAGGCTGTACACAGCAGG + Intergenic
1194049665 X:89053385-89053407 GTCCTGAGGCTACACACAGCAGG + Intergenic
1194082579 X:89486844-89486866 GTTCCTAGGCTGCACGAAGCAGG + Intergenic
1194082931 X:89490346-89490368 GCCCCTAGGATGCACACAGCAGG + Intergenic
1194125601 X:90012613-90012635 GTCCTGAGGCTGCACATAACAGG - Intergenic
1194185026 X:90765266-90765288 GTCCCTAGGCTACGCAAAGCAGG + Intergenic
1194194069 X:90870483-90870505 GTCCCCAGGCTGCACAGCAGGGG - Intergenic
1194253998 X:91613861-91613883 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1194328922 X:92557069-92557091 GCCCTGAGGCTGCACAGAGAAGG + Intronic
1194339483 X:92691661-92691683 GTCTCAAGGCTGCATAGAGCAGG - Intergenic
1194463041 X:94196656-94196678 GTCCCTAAGCTACACACAGCAGG - Intergenic
1194495897 X:94616223-94616245 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1194499149 X:94658660-94658682 GTTCCAAGGCTGCATAGAGCAGG - Intergenic
1194522461 X:94935765-94935787 ATCCAAAGGCTTCACAGAGCAGG - Intergenic
1194527042 X:94989694-94989716 ATCCTTAGGCTGCACACAGCAGG + Intergenic
1194534282 X:95086257-95086279 GTCTCAAGGCTGCATAGAACAGG + Intergenic
1194542412 X:95190558-95190580 GTTCCTGGGCTGCACACAGCAGG + Intergenic
1194554248 X:95337766-95337788 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1194560291 X:95411683-95411705 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1194578498 X:95642114-95642136 GTCCCTAAGCTGCACACAGCAGG + Intergenic
1194624595 X:96213504-96213526 GTCCCAAGGCTGCACAGATCGGG + Intergenic
1194838646 X:98713205-98713227 GTCCCTAGATTGCACAGAGCAGG - Intergenic
1194893252 X:99406588-99406610 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1194905920 X:99576272-99576294 CTCCCAAGGCTGCACAGAGCAGG - Intergenic
1194920575 X:99759876-99759898 GTCCCAAGGCTGCATGCAGCAGG - Intergenic
1194929391 X:99867774-99867796 GTCTCAAGGCTGCACAGAGCAGG - Intergenic
1195126766 X:101815666-101815688 GTCCCTAGGTTGCACAGAGCAGG + Intergenic
1195536283 X:106012650-106012672 ATCCTGAGGCTGCACAGAGTAGG - Intergenic
1195608386 X:106835359-106835381 GTCCTGAGGCTGCATAGAGCAGG + Intronic
1196136919 X:112220380-112220402 GTCCCAAGGCTGCACACAGTAGG + Intergenic
1196313532 X:114196769-114196791 ATCCCAAGGCTGCAAACAGCAGG + Intergenic
1196314905 X:114211091-114211113 GTCCTGAGGCTGCATAGAGGAGG + Intergenic
1196368315 X:114947336-114947358 GTCCCTAGGCTGCACAGCACAGG + Intergenic
1196478286 X:116113783-116113805 GTCCCTATGCTGCATAGGGCAGG + Intergenic
1196512806 X:116532296-116532318 ATCCCAAGGCTCCACAGAGAAGG + Intergenic
1196548751 X:116996517-116996539 GTCCCTAGGCTGCACACAACAGG + Intergenic
1196565188 X:117196721-117196743 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1196930441 X:120676285-120676307 GTCCCGAGGCTGCATAAAGCAGG + Intergenic
1197023494 X:121718275-121718297 ATCCCTAGGCTGCACATAGCAGG + Intergenic
1197057060 X:122134529-122134551 GTCTTGAGGCTGCACACAGCAGG - Intergenic
1197109591 X:122756653-122756675 GTTCCGGGGCTGCACAGAGCAGG + Intergenic
1197128236 X:122972819-122972841 GTCCCTAGCCTGCACACAGCAGG - Intergenic
1197301732 X:124789215-124789237 GTTCCTAGGCTGCACACAGCAGG + Intronic
1197349815 X:125370043-125370065 GTCCATAGGCTGCACACAGCAGG + Intergenic
1197375280 X:125675390-125675412 GTCCTGAGGCTGCATAGAGCAGG + Intergenic
1197442868 X:126512101-126512123 GTCTCTAGGCTGCACATAGCAGG + Intergenic
1197536151 X:127691291-127691313 GTCCCAAGGCTGCATAGAGTAGG - Intergenic
1197560557 X:128015162-128015184 GTCCTGAGACTGCATAGAGCAGG + Intergenic
1197583246 X:128311090-128311112 GTCCAAAGGCTGCACAGAGCTGG + Intergenic
1198178914 X:134185010-134185032 GAACCAAGGCTGCAGAGAACTGG + Intergenic
1198274645 X:135089337-135089359 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1198566038 X:137906593-137906615 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1198803939 X:140475239-140475261 GTCCCAAGGCTCCACACAGCAGG - Intergenic
1198947073 X:142027198-142027220 GTCCCCAGGCTGCATAGAGCAGG + Intergenic
1198952081 X:142082778-142082800 GTCACGAGGCTGCACAGAGCAGG + Intergenic
1198966854 X:142236831-142236853 GTCCTGAGGCTGCATAGAGCAGG - Intergenic
1199003009 X:142662803-142662825 GTCCTGAAGGTGCACAGAGCAGG - Intergenic
1199060586 X:143351075-143351097 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1199071135 X:143476892-143476914 GTCCCTAGGTTGCATACAGCAGG - Intergenic
1199083686 X:143605794-143605816 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1199193270 X:144997184-144997206 GTCCCAAGGCTGTACACAGTAGG - Intergenic
1199206977 X:145160241-145160263 GTCCTGAGACTGCACACAGCAGG + Intergenic
1199220357 X:145309733-145309755 GTCTCAAGGCTACATATAGCAGG + Intergenic
1199258931 X:145748365-145748387 GTCCCGAGGCTGCATAGAGCAGG + Intergenic
1199309560 X:146307304-146307326 GTTCTGAGGCTGCACAGAGCAGG - Intergenic
1199310079 X:146311625-146311647 GTCCCTAGGCTGCAAAGAGAAGG + Intergenic
1199317737 X:146400478-146400500 GTCCCTAGGTTGCACATAGCGGG - Intergenic
1199346525 X:146747091-146747113 GTCCTGAGGTTGTACAGAGCAGG + Intergenic
1199357148 X:146875642-146875664 GTCCAGAGTCTGCACACAGCAGG - Intergenic
1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG + Intergenic
1199560687 X:149159665-149159687 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1199566062 X:149217002-149217024 GTCCCTAAGCTGCACACAGCAGG - Intergenic
1199580745 X:149357792-149357814 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1199686939 X:150273316-150273338 GGCCAGAGGCTGCACACAGCAGG - Intergenic
1199776144 X:151013527-151013549 GTCTCAAGGCTGTAAACAGCAGG + Intergenic
1199908782 X:152262139-152262161 GTCCCCAGGCTGCATGGAGCAGG + Intronic
1199928399 X:152493916-152493938 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1200096736 X:153668082-153668104 GTGTCAAGGCAGCCCAGAGCTGG + Intergenic
1200130949 X:153845472-153845494 GTCCCAAGGATGCAGAGGGCGGG - Intergenic
1200356988 X:155562348-155562370 TTCCCAAGGCTGCACAGAGCAGG + Intronic
1200435227 Y:3142725-3142747 GTTCCTAGGCTGCACGAAGCAGG + Intergenic
1200531654 Y:4347375-4347397 GTCCCTAGGCTACGCAAAGCAGG + Intergenic
1200540679 Y:4452867-4452889 GTCCCCAGGCTGCACAGCAGGGG - Intergenic
1200572782 Y:4853438-4853460 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1200637628 Y:5676271-5676293 GCCCTGAGGCTGCACAGAGAAGG + Intronic
1200647868 Y:5808442-5808464 GTCTCAAGGCTGCATAGAGCAGG - Intergenic
1201300756 Y:12502690-12502712 GTACCAAGACGGCACTGAGCTGG + Intergenic