ID: 1104587930

View in Genome Browser
Species Human (GRCh38)
Location 12:130062527-130062549
Sequence ATGTAGGGCACCATGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587930_1104587941 19 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587941 12:130062569-130062591 GTCTTGGCTAAAAGGGGCAAAGG No data
1104587930_1104587935 3 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587935 12:130062553-130062575 AGCTGCTTCAGCTCCCGTCTTGG No data
1104587930_1104587942 30 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587942 12:130062580-130062602 AAGGGGCAAAGGTACAGCTCAGG 0: 13
1: 339
2: 875
3: 1374
4: 1599
1104587930_1104587936 11 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data
1104587930_1104587938 13 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587930_1104587937 12 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587930 Original CRISPR ATGTAGGGCACCATGTCCCA AGG (reversed) Intergenic
No off target data available for this crispr