ID: 1104587931

View in Genome Browser
Species Human (GRCh38)
Location 12:130062542-130062564
Sequence GCTGAAGCAGCTGGGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587931_1104587937 -3 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587931_1104587941 4 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587941 12:130062569-130062591 GTCTTGGCTAAAAGGGGCAAAGG No data
1104587931_1104587942 15 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587942 12:130062580-130062602 AAGGGGCAAAGGTACAGCTCAGG 0: 13
1: 339
2: 875
3: 1374
4: 1599
1104587931_1104587938 -2 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587931_1104587943 30 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587943 12:130062595-130062617 AGCTCAGGCTATTGCTTCAGAGG 0: 23
1: 445
2: 1050
3: 1313
4: 1534
1104587931_1104587936 -4 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587931 Original CRISPR GCTGAAGCAGCTGGGATGTA GGG (reversed) Intergenic
No off target data available for this crispr