ID: 1104587932

View in Genome Browser
Species Human (GRCh38)
Location 12:130062543-130062565
Sequence AGCTGAAGCAGCTGGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587932_1104587938 -3 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587932_1104587944 30 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587944 12:130062596-130062618 GCTCAGGCTATTGCTTCAGAGGG 0: 24
1: 443
2: 1017
3: 1268
4: 1488
1104587932_1104587936 -5 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587936 12:130062561-130062583 CAGCTCCCGTCTTGGCTAAAAGG No data
1104587932_1104587942 14 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587942 12:130062580-130062602 AAGGGGCAAAGGTACAGCTCAGG 0: 13
1: 339
2: 875
3: 1374
4: 1599
1104587932_1104587943 29 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587943 12:130062595-130062617 AGCTCAGGCTATTGCTTCAGAGG 0: 23
1: 445
2: 1050
3: 1313
4: 1534
1104587932_1104587937 -4 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587937 12:130062562-130062584 AGCTCCCGTCTTGGCTAAAAGGG No data
1104587932_1104587941 3 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587941 12:130062569-130062591 GTCTTGGCTAAAAGGGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587932 Original CRISPR AGCTGAAGCAGCTGGGATGT AGG (reversed) Intergenic
No off target data available for this crispr