ID: 1104587938

View in Genome Browser
Species Human (GRCh38)
Location 12:130062563-130062585
Sequence GCTCCCGTCTTGGCTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104587923_1104587938 30 Left 1104587923 12:130062510-130062532 CCCCCTGCTCTGTGCAGCCTTGG 0: 22
1: 140
2: 432
3: 1052
4: 1746
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587933_1104587938 -10 Left 1104587933 12:130062550-130062572 CCCAGCTGCTTCAGCTCCCGTCT No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587931_1104587938 -2 Left 1104587931 12:130062542-130062564 CCCTACATCCCAGCTGCTTCAGC No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587932_1104587938 -3 Left 1104587932 12:130062543-130062565 CCTACATCCCAGCTGCTTCAGCT No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587925_1104587938 29 Left 1104587925 12:130062511-130062533 CCCCTGCTCTGTGCAGCCTTGGG 0: 52
1: 149
2: 469
3: 1161
4: 1675
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587927_1104587938 28 Left 1104587927 12:130062512-130062534 CCCTGCTCTGTGCAGCCTTGGGA 0: 31
1: 125
2: 617
3: 827
4: 1005
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587930_1104587938 13 Left 1104587930 12:130062527-130062549 CCTTGGGACATGGTGCCCTACAT No data
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data
1104587928_1104587938 27 Left 1104587928 12:130062513-130062535 CCTGCTCTGTGCAGCCTTGGGAC 0: 25
1: 115
2: 322
3: 452
4: 651
Right 1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104587938 Original CRISPR GCTCCCGTCTTGGCTAAAAG GGG Intergenic
No off target data available for this crispr