ID: 1104589636

View in Genome Browser
Species Human (GRCh38)
Location 12:130074094-130074116
Sequence ATCCTCTAGTGCCCAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104589636_1104589640 2 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589640 12:130074119-130074141 AGGCAGTGTGAGAGCCCTATGGG No data
1104589636_1104589641 13 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG No data
1104589636_1104589642 14 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589642 12:130074131-130074153 AGCCCTATGGGCACTGCTGAGGG No data
1104589636_1104589646 25 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589646 12:130074142-130074164 CACTGCTGAGGGGTGCAAAGTGG No data
1104589636_1104589639 1 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589639 12:130074118-130074140 GAGGCAGTGTGAGAGCCCTATGG No data
1104589636_1104589643 15 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589643 12:130074132-130074154 GCCCTATGGGCACTGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104589636 Original CRISPR ATCCTCTAGTGCCCAGACAC AGG (reversed) Intergenic
No off target data available for this crispr