ID: 1104589641

View in Genome Browser
Species Human (GRCh38)
Location 12:130074130-130074152
Sequence GAGCCCTATGGGCACTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104589636_1104589641 13 Left 1104589636 12:130074094-130074116 CCTGTGTCTGGGCACTAGAGGAT No data
Right 1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104589641 Original CRISPR GAGCCCTATGGGCACTGCTG AGG Intergenic
No off target data available for this crispr