ID: 1104592030

View in Genome Browser
Species Human (GRCh38)
Location 12:130092452-130092474
Sequence GAGCCAGGGGTGGCCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104592019_1104592030 8 Left 1104592019 12:130092421-130092443 CCGCCCGACGTGATGGGTGCTAT No data
Right 1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG No data
1104592021_1104592030 5 Left 1104592021 12:130092424-130092446 CCCGACGTGATGGGTGCTATGGA No data
Right 1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG No data
1104592022_1104592030 4 Left 1104592022 12:130092425-130092447 CCGACGTGATGGGTGCTATGGAA No data
Right 1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104592030 Original CRISPR GAGCCAGGGGTGGCCCAGCA GGG Intergenic
No off target data available for this crispr