ID: 1104593532

View in Genome Browser
Species Human (GRCh38)
Location 12:130103935-130103957
Sequence CAGCTTTGACAAATGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104593532_1104593535 -8 Left 1104593532 12:130103935-130103957 CCCATGTCCATTTGTCAAAGCTG No data
Right 1104593535 12:130103950-130103972 CAAAGCTGAGACACCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104593532 Original CRISPR CAGCTTTGACAAATGGACAT GGG (reversed) Intergenic
No off target data available for this crispr