ID: 1104595048

View in Genome Browser
Species Human (GRCh38)
Location 12:130115248-130115270
Sequence GGGGCTTGCGGGAGGCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104595048_1104595058 5 Left 1104595048 12:130115248-130115270 CCACGCCGCCTCCCGCAAGCCCC No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
1104595048_1104595061 19 Left 1104595048 12:130115248-130115270 CCACGCCGCCTCCCGCAAGCCCC No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104595048 Original CRISPR GGGGCTTGCGGGAGGCGGCG TGG (reversed) Intergenic
No off target data available for this crispr