ID: 1104595058

View in Genome Browser
Species Human (GRCh38)
Location 12:130115276-130115298
Sequence CCGTCTGTCCCACTCTTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104595050_1104595058 -3 Left 1104595050 12:130115256-130115278 CCTCCCGCAAGCCCCCTCTGCCG No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
1104595051_1104595058 -6 Left 1104595051 12:130115259-130115281 CCCGCAAGCCCCCTCTGCCGTCT No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
1104595052_1104595058 -7 Left 1104595052 12:130115260-130115282 CCGCAAGCCCCCTCTGCCGTCTG No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
1104595049_1104595058 0 Left 1104595049 12:130115253-130115275 CCGCCTCCCGCAAGCCCCCTCTG No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
1104595048_1104595058 5 Left 1104595048 12:130115248-130115270 CCACGCCGCCTCCCGCAAGCCCC No data
Right 1104595058 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104595058 Original CRISPR CCGTCTGTCCCACTCTTAGA CGG Intergenic
No off target data available for this crispr