ID: 1104595061

View in Genome Browser
Species Human (GRCh38)
Location 12:130115290-130115312
Sequence CTTAGACGGTAGATGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104595048_1104595061 19 Left 1104595048 12:130115248-130115270 CCACGCCGCCTCCCGCAAGCCCC No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595052_1104595061 7 Left 1104595052 12:130115260-130115282 CCGCAAGCCCCCTCTGCCGTCTG No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595050_1104595061 11 Left 1104595050 12:130115256-130115278 CCTCCCGCAAGCCCCCTCTGCCG No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595053_1104595061 0 Left 1104595053 12:130115267-130115289 CCCCCTCTGCCGTCTGTCCCACT No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595055_1104595061 -2 Left 1104595055 12:130115269-130115291 CCCTCTGCCGTCTGTCCCACTCT No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595054_1104595061 -1 Left 1104595054 12:130115268-130115290 CCCCTCTGCCGTCTGTCCCACTC No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595051_1104595061 8 Left 1104595051 12:130115259-130115281 CCCGCAAGCCCCCTCTGCCGTCT No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595057_1104595061 -9 Left 1104595057 12:130115276-130115298 CCGTCTGTCCCACTCTTAGACGG No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595056_1104595061 -3 Left 1104595056 12:130115270-130115292 CCTCTGCCGTCTGTCCCACTCTT No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data
1104595049_1104595061 14 Left 1104595049 12:130115253-130115275 CCGCCTCCCGCAAGCCCCCTCTG No data
Right 1104595061 12:130115290-130115312 CTTAGACGGTAGATGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104595061 Original CRISPR CTTAGACGGTAGATGCTGTC AGG Intergenic
No off target data available for this crispr