ID: 1104602343

View in Genome Browser
Species Human (GRCh38)
Location 12:130162304-130162326
Sequence CGGGCTCCCGGGCCCCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 2, 2: 4, 3: 39, 4: 313}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104602343_1104602354 -9 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602354 12:130162318-130162340 GGGAGCCCGCGGCGGGGCGGCGG 0: 1
1: 2
2: 17
3: 145
4: 1067
1104602343_1104602356 -7 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602356 12:130162320-130162342 GAGCCCGCGGCGGGGCGGCGGGG 0: 1
1: 2
2: 9
3: 105
4: 731
1104602343_1104602360 -1 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602360 12:130162326-130162348 GCGGCGGGGCGGCGGGGAGGAGG 0: 1
1: 12
2: 181
3: 500
4: 2663
1104602343_1104602361 8 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602361 12:130162335-130162357 CGGCGGGGAGGAGGCTGCCCCGG 0: 1
1: 0
2: 10
3: 60
4: 566
1104602343_1104602355 -8 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602355 12:130162319-130162341 GGAGCCCGCGGCGGGGCGGCGGG 0: 1
1: 0
2: 8
3: 113
4: 975
1104602343_1104602362 9 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602362 12:130162336-130162358 GGCGGGGAGGAGGCTGCCCCGGG 0: 1
1: 0
2: 15
3: 106
4: 807
1104602343_1104602358 -4 Left 1104602343 12:130162304-130162326 CCCCCGCGGGGCCCGGGAGCCCG 0: 1
1: 2
2: 4
3: 39
4: 313
Right 1104602358 12:130162323-130162345 CCCGCGGCGGGGCGGCGGGGAGG 0: 1
1: 1
2: 14
3: 188
4: 1177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104602343 Original CRISPR CGGGCTCCCGGGCCCCGCGG GGG (reversed) Intergenic
900087248 1:904454-904476 CGGCCACCCGGGCCTGGCGGTGG - Intergenic
900109752 1:1000433-1000455 CCGGCTCCCGGCCCCCTGGGCGG - Intergenic
900314840 1:2051387-2051409 CGGGCTCACAGGCACAGCGGAGG + Intronic
900393446 1:2443665-2443687 CGGGGGCGCGGGCTCCGCGGCGG - Intronic
900633892 1:3652494-3652516 CGGGCTGCCCGGCCCCTAGGCGG - Intronic
901496867 1:9627288-9627310 CGGGCACCCGGGCTCCGTGGCGG + Intergenic
902208894 1:14890635-14890657 CAGACTTCCGGGCCCCACGGCGG + Intronic
902286087 1:15409712-15409734 CGCGCTCCCCAGCCTCGCGGGGG + Intergenic
903055532 1:20633641-20633663 GGGGCGGCCGGGCCCGGCGGCGG + Exonic
903724716 1:25431554-25431576 CTGGCCCCCGAGCCCCCCGGTGG + Intronic
903750437 1:25617566-25617588 CGCTCGCCCGGGCCCCGCCGAGG + Exonic
903792701 1:25905900-25905922 GGCGCTCCCGGGCCCCACGAGGG - Intronic
904181367 1:28668895-28668917 CGGGCGCGGGGGCCGCGCGGCGG + Intronic
906365556 1:45206505-45206527 CGCGCTCCCGGGCCCGGCCGCGG - Exonic
909475188 1:76074493-76074515 CGGGGACCTGGGTCCCGCGGGGG - Intergenic
911208737 1:95117911-95117933 GGGGCGCCCGGGCGGCGCGGGGG - Exonic
913963153 1:143354336-143354358 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914022824 1:143885087-143885109 CCTGCTCCCGGGCCCCGGCGCGG + Intergenic
914057509 1:144179922-144179944 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914121637 1:144786444-144786466 CGGAGTCCCCGGCCCCCCGGAGG - Intergenic
914661311 1:149793031-149793053 CCAGCTCCCGGGCCCCGGCGCGG + Intronic
914803102 1:150974578-150974600 CCGGCGCCCGAGCCCCGCGCGGG - Intronic
915345540 1:155195169-155195191 CGGGATCCCGGGCCCCGGGCGGG + Intergenic
918388767 1:184037061-184037083 CGGGCCCCGGGCCGCCGCGGCGG - Intronic
921155167 1:212433239-212433261 CGGGCGCCCTGGGCCGGCGGGGG + Intronic
921923181 1:220690584-220690606 CGGGGACCCGGGGCGCGCGGAGG + Exonic
922586330 1:226737243-226737265 GGGGCTCCGGGGCTCCTCGGGGG + Exonic
922661171 1:227431740-227431762 GGGGCTCCGGGGCCTCGCTGGGG + Intergenic
922768067 1:228166233-228166255 CGGGCGCCCGGGGCCTGCAGAGG + Intronic
1064354387 10:14604277-14604299 CTCGCTCCCGGCGCCCGCGGCGG + Intronic
1065022036 10:21509136-21509158 CGGCCTCCAAGGCCCCGCGCGGG - Intergenic
1065025228 10:21534533-21534555 TGGGCTGCCGGGCCGGGCGGGGG + Intronic
1066004558 10:31134344-31134366 CGGTCCCCCGGGACCCGCGGTGG + Intergenic
1067478817 10:46582617-46582639 AGGGCACTCGGGCCCCGCGCTGG - Intronic
1067615921 10:47759184-47759206 AGGGCACTCGGGCCCCGCGCTGG + Intergenic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1070257601 10:74825422-74825444 CGGGCTGGCGGGCGGCGCGGGGG + Intergenic
1071285373 10:84139614-84139636 CGGGCGCCCGGGATCCCCGGTGG + Intronic
1073122535 10:101131506-101131528 CCGCCGCCCGGGCCCCCCGGTGG + Exonic
1073325824 10:102643675-102643697 CGGGCGCCCGGGCTCTGCCGAGG - Intergenic
1074522693 10:114239691-114239713 CGGGCTGCGCGGCCCCGCCGAGG + Intronic
1076483721 10:130802052-130802074 CGGGCTCCCGGGTCCACCGTTGG + Intergenic
1076999558 11:315844-315866 CGGGATCCCGGGGCCCTCGCTGG - Intergenic
1077106875 11:845989-846011 CGGGCACTGGGGCCCCGCAGGGG + Intronic
1077320305 11:1938048-1938070 CAGGCTCCTGGGCCCCTCAGAGG + Intronic
1077333295 11:1992838-1992860 CGGGCTCCCAGCCCCCGCCCCGG + Intergenic
1077367300 11:2166361-2166383 CCTGCTCCCGGGCCCCGCCAAGG - Intronic
1078934236 11:15938078-15938100 TGGGCTCCCGGGCCGGGAGGCGG - Intergenic
1080034847 11:27700345-27700367 CGGGCTCCCGGGCCGGACAGAGG - Intronic
1080385970 11:31811490-31811512 CGGGCTCGGGGGCCCTGCGCCGG - Intronic
1081574541 11:44310823-44310845 CGAGCTCGCGGGCGCCGCTGCGG + Intergenic
1081705527 11:45180542-45180564 CGGGCGCCCGGGCGGGGCGGTGG - Intronic
1082179678 11:49102574-49102596 CGGGCACCCGGGCTCAGGGGAGG + Intergenic
1083997214 11:66278402-66278424 CTTGCGCCCGGGCCCCGCGCTGG + Exonic
1084174372 11:67415842-67415864 CGGGCGCCCGCTCCCCGCGGCGG + Intronic
1084310266 11:68312654-68312676 CGGGCTCCATGGCGCGGCGGCGG - Exonic
1084311243 11:68317465-68317487 AGGGCTCCAGGCCCCCTCGGGGG - Intronic
1084546759 11:69818625-69818647 CGCGCTGCGGGGCCCCGCGGGGG - Intronic
1086685604 11:89730338-89730360 CGGGCACCCGGGCTCAGGGGAGG - Intergenic
1089689219 11:120176510-120176532 AGGGCTCCAGGGGCCAGCGGTGG - Intronic
1090345049 11:126062825-126062847 CGGGCTCCCGGGCTCAGGGGAGG + Intronic
1090636464 11:128693209-128693231 TGGGCTCCCGGTGCCCGCAGAGG - Intronic
1202816275 11_KI270721v1_random:48019-48041 CGGGCTCCCAGCCCCCGCCCCGG + Intergenic
1092695928 12:11171350-11171372 CTGGCTCATGGCCCCCGCGGCGG + Intronic
1092894801 12:13001199-13001221 CGGGCTCTCGGGCGCTCCGGCGG - Intergenic
1094841536 12:34344507-34344529 GGAGCTGCTGGGCCCCGCGGGGG - Intergenic
1095099294 12:38163716-38163738 CCGGCTGCCGGGCCACGCGCAGG + Intergenic
1096495510 12:52037316-52037338 GGGGGTCCCGGGCGCCGCGAGGG - Intronic
1098369189 12:69739078-69739100 CGGGCGCGCGGGCGCCGAGGGGG - Intronic
1101351151 12:103930649-103930671 GGGGATCCCGGGGCCTGCGGTGG + Intronic
1101371942 12:104138296-104138318 CGGGCGCGCGGGCGGCGCGGAGG - Intergenic
1102457183 12:113077990-113078012 GGGGCGCCCGGGCTCCGTGGGGG - Exonic
1102854083 12:116277907-116277929 CGGGCGGCCGGGCTCCCCGGCGG + Intergenic
1103534768 12:121626838-121626860 GGGGCTCCCCGTCCCCGCTGCGG - Exonic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104750617 12:131235923-131235945 CGGGCCCCCGGGCTCCCCTGTGG + Intergenic
1104782105 12:131428537-131428559 CGGGCCCCCGGGCTCCCCTGTGG - Intergenic
1104835308 12:131786465-131786487 CCCGCTCCCGGTCCCCTCGGAGG + Exonic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1106226282 13:27789641-27789663 GGGGCTCCCGGGCCCCTCCTGGG + Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1106555158 13:30803108-30803130 CGGGCTCCCGCGCCCTGGGGTGG + Intergenic
1106708989 13:32311439-32311461 GGCGCTCCCGGGCCCTGCGGAGG - Exonic
1106735651 13:32586221-32586243 CCTTCTCGCGGGCCCCGCGGCGG + Intergenic
1107548754 13:41456984-41457006 CAGGCCCCCGCGCTCCGCGGTGG + Intergenic
1107833994 13:44398861-44398883 TGGGCTCCCGGGCCCCAAGCAGG - Intergenic
1108063450 13:46554074-46554096 CGGCTTCCTGGGCCCCGCGCAGG + Intronic
1110318508 13:74135306-74135328 GCCGCCCCCGGGCCCCGCGGGGG - Intergenic
1112291027 13:98143761-98143783 CGGGCTGCGGGGCTCCGCGCCGG + Intronic
1113379014 13:109786332-109786354 CGGGCTCTCGGGCGGCGCCGGGG + Exonic
1113800641 13:113084702-113084724 CTGGCTCCCAGGCTCCGCTGGGG - Intronic
1113831234 13:113297355-113297377 CGGACTGCCGGGCGCTGCGGTGG - Exonic
1115819381 14:37197854-37197876 CGCGCTGCCGGGCCGCGAGGCGG - Intergenic
1117251868 14:53946876-53946898 GGAGCTCCCAGGCCCGGCGGCGG - Intergenic
1117478466 14:56119306-56119328 CGGGCTGCGGCGGCCCGCGGCGG - Intronic
1119228002 14:72958735-72958757 GGGGCTCCCGGGGCGCGCCGGGG + Exonic
1119410245 14:74425938-74425960 CGAGCCCCCGAGCCCCGCGGAGG - Exonic
1119519702 14:75277108-75277130 CGGCCTCCCCGGCCCGGCCGCGG - Intergenic
1120030109 14:79631510-79631532 CGGGCTCCGTGGCCCCGCACTGG + Intronic
1121828884 14:97033248-97033270 CGGGCTCCCTGGCCCTGAGGTGG - Intergenic
1122610005 14:102975848-102975870 CCGGCTCCGGGGCCAGGCGGGGG - Intronic
1123630468 15:22257251-22257273 CGGGGCTCCGGACCCCGCGGCGG + Intergenic
1123710001 15:22980229-22980251 GGGGGACCCGGACCCCGCGGAGG + Intronic
1124340099 15:28885280-28885302 CGCTCCCCAGGGCCCCGCGGAGG + Intronic
1124392177 15:29269460-29269482 CTGGCTCCTGGGCCCCACGGCGG + Exonic
1128743175 15:70097015-70097037 CGGGCGCCGGGGCCGGGCGGCGG + Exonic
1129188861 15:73926377-73926399 CGGGCCATAGGGCCCCGCGGAGG + Intronic
1131367502 15:91853264-91853286 CGGGGCACGGGGCCCCGCGGCGG - Intergenic
1131431960 15:92394708-92394730 CGGGCTCCCGGGCCGGCGGGAGG - Intronic
1131517606 15:93089310-93089332 CGGGCGCCCGGGCCGCGGGCGGG + Intergenic
1131832219 15:96361222-96361244 CGGGGTCCCGGGGCCGGGGGCGG - Intergenic
1132314562 15:100880250-100880272 CGGGCGGCCCGGCCCCGCGCGGG - Intronic
1132663778 16:1072744-1072766 CGGGCTCCCGGGCGCCGGCTGGG - Intergenic
1132744992 16:1432811-1432833 GGGGCTGCCGGGACCCTCGGGGG - Intergenic
1132831352 16:1929895-1929917 CGGCCTCCCGGGCCCGGGCGCGG - Intergenic
1132943591 16:2520415-2520437 GCGGCTCCGGAGCCCCGCGGCGG - Exonic
1134024190 16:10942052-10942074 CGGCCGCCCGGGCGCCGCAGCGG - Exonic
1134051765 16:11142254-11142276 CAGGTTCCCGGGCCCTGAGGAGG - Intronic
1134974805 16:18561998-18562020 GGGGCTGCTGGGGCCCGCGGTGG - Exonic
1135745711 16:25014979-25015001 CGGGCTCCCGAGACCTGCAGGGG - Intronic
1135976101 16:27109810-27109832 GGGGCAGCAGGGCCCCGCGGAGG - Intergenic
1136220075 16:28823143-28823165 CGGGCAGCCGGGGCCCGCCGTGG - Exonic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1137033126 16:35543674-35543696 CGAGCTCCGGGGCCCAGCGCCGG - Intergenic
1140400467 16:74666800-74666822 CGGGCTCGCGAGCCCGGCCGCGG - Exonic
1141200794 16:81896131-81896153 CGGGCTCTAGAGCCCCGAGGAGG + Intronic
1141430653 16:83968883-83968905 GGGGCTCCGGGTCCCAGCGGAGG - Intronic
1141663131 16:85452516-85452538 GGGGCTTCTGGGCCCCGCCGGGG - Intergenic
1141839730 16:86567043-86567065 CTGGCTCCAGGACCCGGCGGCGG - Intergenic
1141972622 16:87493396-87493418 CGGGGCTCCGGACCCCGCGGCGG - Intergenic
1142120278 16:88383474-88383496 CGAGCGCCGGGGCCCGGCGGGGG + Intergenic
1142223677 16:88867119-88867141 CGGGGTCCTGGGCCCAGAGGAGG + Intergenic
1142285654 16:89170551-89170573 CGGGCTCCCCGGCCCGGCCCTGG + Intergenic
1142336157 16:89490560-89490582 CTGGCTCCAGGACCCAGCGGCGG + Exonic
1142417254 16:89949332-89949354 CGGTCTCCCGGGCTCCTCGGGGG - Intronic
1142586707 17:979005-979027 CGGGATCCCGGGGGCCGAGGGGG + Intronic
1142670544 17:1485752-1485774 CCGGGTCCCGGGCTCGGCGGCGG + Intronic
1143105918 17:4530529-4530551 CTGGCTCCTGGGCCCTGCAGGGG + Intronic
1143483364 17:7239312-7239334 CGGGATCCCCGGCTCCGGGGAGG - Exonic
1147006379 17:37407061-37407083 CGGGCTGCGGGCCCCGGCGGCGG + Intronic
1147168647 17:38605824-38605846 CGGGGGCGCGGGCCCCGCCGGGG + Exonic
1147179464 17:38674978-38675000 CGGGCTCGCGGCCCCGGCGCTGG - Exonic
1147994522 17:44353657-44353679 CGCGCCCCGGGGGCCCGCGGGGG - Exonic
1148081059 17:44967921-44967943 CCGGCGCCGGGGCCCCGCGCGGG + Exonic
1148694840 17:49552577-49552599 AGGGCTCCCAGGCCCCACCGCGG - Intergenic
1148804804 17:50258809-50258831 GGGGCTCCCGGGCCCTGGGGTGG - Intergenic
1148894421 17:50831617-50831639 CGGAGGCCTGGGCCCCGCGGAGG + Intergenic
1152209054 17:78993372-78993394 TGGACCCCCGGGCCCCACGGAGG - Exonic
1152362295 17:79838347-79838369 CGGGCTCCTGGGCCACGAGGGGG - Intronic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1152725346 17:81942242-81942264 TGGGCTCCTGGGGCTCGCGGGGG + Intronic
1152738546 17:82009033-82009055 CGGGCTCCCGGTCCACGGGCTGG - Exonic
1152748265 17:82051170-82051192 CAGGCTCCCGAGGCCCGGGGAGG - Intronic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1157662735 18:49460228-49460250 CGGGCGCCTGGGCCACCCGGAGG - Intronic
1157849031 18:51030425-51030447 CGAGCTCCCGGGCCGCCCTGCGG - Exonic
1160005840 18:75068448-75068470 GGGGCTGCCTGGCCCTGCGGAGG - Intergenic
1160821738 19:1062166-1062188 TGGGTTCCCGGGCCACGCTGGGG - Exonic
1160824192 19:1071715-1071737 CGGGGTCTCAGGCCCGGCGGCGG + Intronic
1160992212 19:1864421-1864443 CACCCTCCCGGGCCCCGCCGCGG - Intergenic
1161015003 19:1979120-1979142 CGGGCGCCCGGACCCCGCTGAGG + Intronic
1161086952 19:2339758-2339780 TGGGCTCCCGAGCCCCGTGTCGG + Intronic
1161108692 19:2456596-2456618 CGCGATCGCGCGCCCCGCGGTGG + Intronic
1161643195 19:5436733-5436755 CGAGCTCCCGGGACCCGGGAGGG - Intergenic
1162496532 19:11026238-11026260 CAGGCCACCGGGCCCCGCTGCGG - Intronic
1163146062 19:15379950-15379972 CGGGCCGTCGGGCACCGCGGTGG - Intergenic
1163159709 19:15457366-15457388 CGGGCTCCAGGGCCCCGCAGAGG + Exonic
1163602676 19:18258255-18258277 CGAACTCCCGGGGCCAGCGGAGG + Intronic
1164624100 19:29715207-29715229 CCAGCTCCCCAGCCCCGCGGAGG + Intronic
1165058667 19:33194537-33194559 CGGCGTCACGGGCCCTGCGGGGG - Intronic
1165938285 19:39402867-39402889 CTGGCCCCAGCGCCCCGCGGGGG + Intergenic
1166280293 19:41788051-41788073 GGAGCTCCCGGCCCCTGCGGTGG + Intergenic
1166396449 19:42444691-42444713 GGAGCTCCCGGCCCCTGCGGTGG - Intergenic
1167159037 19:47755701-47755723 GGGTGTCCTGGGCCCCGCGGGGG + Intronic
1167375297 19:49107899-49107921 CCCGCTCCCGGGACCGGCGGAGG + Exonic
1168242537 19:55094660-55094682 CGGACTCCCGGGACCGACGGAGG - Exonic
1168293782 19:55369398-55369420 CGGGCTCCCGCGGCCCGGGGAGG - Intronic
1168335124 19:55593043-55593065 GCTGCTCCTGGGCCCCGCGGGGG - Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
1202696993 1_KI270712v1_random:132595-132617 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
927156545 2:20224450-20224472 CGGGGGCCCGGCCGCCGCGGTGG + Intronic
927181114 2:20447333-20447355 GCTGCACCCGGGCCCCGCGGTGG - Exonic
927658366 2:24971430-24971452 CCGGCTCCCAGGCCCGGCTGGGG + Intronic
927702019 2:25275067-25275089 AGGGCTCCCGGGGCCGGCTGCGG - Exonic
927713828 2:25340934-25340956 CGGGCACCCACGGCCCGCGGTGG + Intronic
927714312 2:25342171-25342193 GGGGCCCCGGGGCGCCGCGGCGG + Intronic
927842510 2:26454646-26454668 GGGACTCGCGGGCCCCGCTGAGG + Exonic
929218105 2:39437072-39437094 CCGGCTCCCGGCTCCCCCGGCGG + Exonic
929539621 2:42810073-42810095 CTTGCTCCCGCGCCCCGGGGAGG - Intergenic
930011407 2:46940992-46941014 CGGGCGCCGGGGCTCCGCGCGGG + Intronic
932780242 2:74554713-74554735 CGCGCTTCCTGGCCCTGCGGCGG - Exonic
932790118 2:74648002-74648024 CGGGCCTGGGGGCCCCGCGGAGG + Exonic
934278154 2:91589609-91589631 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
934728121 2:96638172-96638194 AGGGCTCCCGGGGCATGCGGGGG - Intronic
935301685 2:101698213-101698235 CGGGCGCTCGGGCGCCGCCGTGG + Intronic
935710378 2:105893196-105893218 TCGCCTCCCGGGCCCCACGGTGG + Exonic
937933052 2:127220184-127220206 TGGGCGGCGGGGCCCCGCGGCGG - Intergenic
938583904 2:132670631-132670653 CAGGCTCCCGCGGCCCGCAGCGG - Intronic
942116754 2:172735812-172735834 CGGGCTCCCGCGGCCTGGGGCGG - Intronic
942240806 2:173963717-173963739 CGGGCGCCCGGCCTCGGCGGGGG + Intronic
942459111 2:176157423-176157445 CGCGCTCCCGCGCCCGCCGGGGG - Intronic
944428063 2:199604105-199604127 GGGGCTCCCGGGAGGCGCGGTGG - Intergenic
944615112 2:201451805-201451827 CGCCCTCCCGCGCCCCGCGCCGG + Exonic
947549653 2:231037430-231037452 CGGACCCCCGGGCCCCCGGGCGG - Intergenic
947641429 2:231709632-231709654 GGGGCGCCCGGGCCCCGTGGCGG + Intronic
947720912 2:232368664-232368686 GGGCCACCTGGGCCCCGCGGGGG + Intergenic
947846933 2:233251971-233251993 GGGGCGGGCGGGCCCCGCGGAGG + Intronic
948166197 2:235864512-235864534 GGGGCTCCGGGGCCGCGCAGTGG - Intronic
948674468 2:239588883-239588905 GGGGCTCCAGGGCCCTGCGCAGG - Intergenic
1168855074 20:1002384-1002406 CGCGCTCCCGGGCCCCGAGCTGG - Intergenic
1168991659 20:2101700-2101722 CGGGCTCCGGGTCTCCGCAGCGG - Exonic
1169142446 20:3234053-3234075 CGGTCTCCCGGCCCGGGCGGGGG - Intronic
1169831442 20:9829999-9830021 GGGGCTCCTGGGCCCAGTGGGGG - Intronic
1170562711 20:17570396-17570418 TGGGCCCCCGCGCCCCGGGGTGG + Intronic
1172245738 20:33443828-33443850 TCGGCTCCCGGGCCCCGCCCCGG - Exonic
1172474520 20:35226870-35226892 CTGCCTCCCGGGCGCCGCGCGGG + Exonic
1173672975 20:44810629-44810651 CGGGCTCCCACGCCCCGCAGCGG - Intergenic
1173741840 20:45407028-45407050 TGGGCTCCGCGGCCCCCCGGGGG + Intronic
1174343792 20:49915157-49915179 CAGGCTCCTGGGACCCGCCGAGG - Intronic
1175149875 20:56925320-56925342 TGCGCTCCCGTGCCCCACGGGGG + Intergenic
1175912359 20:62410935-62410957 TGGGCTCCCGGGCCCCTCAGTGG + Exonic
1175922612 20:62457192-62457214 GGGGCTCCAGGACCCCGCGGGGG - Intergenic
1175956040 20:62609933-62609955 CGGCATCCCGGGCCCCTCGCTGG - Intergenic
1176037067 20:63044742-63044764 AGGGCTCCCAGGCCCCGGTGAGG + Intergenic
1176091006 20:63318634-63318656 CGTGCTCCCGGGGCCCGTGAGGG - Intronic
1176112418 20:63416656-63416678 CGGGCTCCCTGATCCCACGGCGG + Intronic
1176221074 20:63969662-63969684 CGAGCCCCCGCGCCCCGCGCCGG - Intronic
1176232219 20:64038361-64038383 CTCTCTCCAGGGCCCCGCGGCGG - Intronic
1176550026 21:8217036-8217058 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1176568953 21:8400071-8400093 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1176576867 21:8444306-8444328 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1176871228 21:14084500-14084522 CGTGCTCCGGGGCTCCGGGGCGG + Intergenic
1179411864 21:41168397-41168419 AGGGGTCCCGGGTCCCGGGGTGG - Exonic
1181085488 22:20437702-20437724 CCGGCTCCCCGGCGCCGCGCCGG + Exonic
1182903846 22:33920434-33920456 CGGGCGCCCGGGCTCCGGCGCGG + Intronic
1183058701 22:35322338-35322360 CGGCCTCCCTGCCCCCGCGGAGG - Intronic
1183093863 22:35540935-35540957 CGGGCTGCCGGGCTCGGCCGCGG - Exonic
1183294066 22:37019592-37019614 GGGGCCTCCGGGACCCGCGGGGG + Intronic
1183486429 22:38089569-38089591 CGGCCTGCTGGGCCCCGCGCTGG - Exonic
1184759639 22:46537264-46537286 CGGGCGCCCGGCCCTCGGGGCGG + Intergenic
1184759680 22:46537409-46537431 CGCCCTCCCGGGACGCGCGGAGG - Intergenic
1185344279 22:50304625-50304647 CAGGCTCTGGGGCCCCGGGGAGG - Intronic
1203254916 22_KI270733v1_random:133362-133384 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1203262972 22_KI270733v1_random:178441-178463 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
949559377 3:5187969-5187991 CCGGCCCACGGGCCCCGAGGTGG - Exonic
951543741 3:23806377-23806399 CCCGCTCCCGGGCCCCTCGGTGG - Intronic
952316789 3:32238744-32238766 CGGGCTCCCGAGCTGCGCTGGGG - Exonic
952888285 3:38024936-38024958 GGAGGTGCCGGGCCCCGCGGAGG + Intronic
952942294 3:38454075-38454097 CGGGCTCCGGGGCGACGCGGGGG - Exonic
953705215 3:45225829-45225851 CGAGCGCCCGGGCCCGGAGGAGG - Exonic
954135379 3:48579892-48579914 GGGGCTCCAGGGATCCGCGGAGG + Intronic
956675034 3:71725319-71725341 GCGGCTCCCGGGCCCCGGCGGGG + Exonic
958814677 3:98901959-98901981 CAGGCGCCCGGGCCGGGCGGGGG - Intergenic
959085649 3:101849153-101849175 CGGGCGCCCAGGCCCGGCGGGGG + Intronic
960586158 3:119322986-119323008 CGGGCGCCCGGACCCCGGGGCGG - Intronic
962468815 3:135687000-135687022 CTGGCTCCTGGGCCCACCGGCGG - Intergenic
963605905 3:147411409-147411431 CTGGCTCCCGGCAGCCGCGGAGG + Intronic
963733128 3:148991666-148991688 CGGGGTCCCGGGGCTGGCGGCGG - Intronic
965962112 3:174441173-174441195 CGGCGCCCCGGGCCCCGCGCAGG - Intronic
966693000 3:182760698-182760720 CGGGCACCAGGGGCCTGCGGAGG + Intergenic
966743486 3:183254357-183254379 CGGGCTGCCGGGGCCCGCGGTGG - Intronic
966974378 3:185071607-185071629 CGGACTCCAGGCCCCCGGGGTGG + Intergenic
968196718 3:196712688-196712710 CCGGCTCCCGGGCCTCTCGGCGG + Intronic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968317477 3:197736778-197736800 AGGGCTCCCGGGGCCCCCTGGGG + Intronic
968556425 4:1248439-1248461 CGCGCTCCCGGGCCACTCGCGGG - Intronic
968698021 4:2042184-2042206 GGGGCTCCCGGGCCCGGGGTGGG + Intronic
968831646 4:2935177-2935199 CGGGCTTCGGGGCCCCACGCTGG + Intergenic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
971238876 4:24869365-24869387 TGGGCTCCTGGGCCCTGCTGTGG + Intronic
973686786 4:53378074-53378096 CGTGCCCCCAGTCCCCGCGGCGG + Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
978532487 4:109729574-109729596 GGGGCACCCGGGCCCAGCGAGGG - Intronic
981617285 4:146655160-146655182 CGGGCGCCTGGGCCCTCCGGGGG + Intergenic
984793209 4:183633112-183633134 CAGGGTCCCGGGGCCCGTGGTGG + Intergenic
985373091 4:189307728-189307750 CGGGCCCACAGGCCACGCGGCGG + Intergenic
985373457 4:189309366-189309388 CGGGCCCACAGGCCACGCGGCGG + Intergenic
985575182 5:670542-670564 CTGGCTGCTGGGCCCCACGGGGG + Intronic
985611599 5:892550-892572 CGGGGTCCCGGGCACGGGGGAGG - Intronic
985651173 5:1108467-1108489 GGGGCTCCCGGGCACAGCCGCGG + Intronic
985660799 5:1155758-1155780 CGGGGTCGGGGGCCCGGCGGGGG + Intergenic
986330630 5:6713951-6713973 CGGGCGCGCGGGCCCCGCGGGGG + Intergenic
989584807 5:43066496-43066518 CGGGCTCCCCCGCCCAGCGCCGG + Intronic
990955155 5:61332817-61332839 CGGGGCCCCGGCCCCCGCGGCGG - Exonic
992487398 5:77210297-77210319 CGCGCACAGGGGCCCCGCGGCGG + Intergenic
998130662 5:139649674-139649696 CTGTCTCCCGAGCCCCGCGTGGG + Intronic
1002185860 5:177454603-177454625 TCGGCGCCCGGGCTCCGCGGCGG + Intronic
1002195208 5:177497466-177497488 CGGGCGCCCGGGGCCTGCTGAGG - Intronic
1002498887 5:179634497-179634519 CGAACTCCCGCGCACCGCGGAGG - Intronic
1002502789 5:179658027-179658049 CGAACTCCCGCGCACCGCGGAGG + Intergenic
1004492461 6:16129434-16129456 CGGCCTCGCGGGACCCGCCGGGG - Intronic
1006187656 6:32190035-32190057 CCGGCTCCCGGCTCCCCCGGGGG + Exonic
1007368160 6:41408913-41408935 CGGGTCCCCGGGCCCCGCTCGGG - Intergenic
1012548355 6:100446690-100446712 CCGGCGCCCAGGCCCCGCGCGGG - Intronic
1012912726 6:105136604-105136626 CCGGCTCCCGCGCTCTGCGGCGG - Intronic
1012916877 6:105179991-105180013 CGGGCTCCGGAGCGGCGCGGCGG + Intronic
1019186710 6:170224712-170224734 CTGCCTCCTGGGCCCCGCTGGGG + Intergenic
1019551926 7:1607393-1607415 TGGGCTCCCGGGCCCCCGGCTGG + Intergenic
1019642657 7:2112683-2112705 AGGGCCCCAGGGCCCCTCGGTGG - Intronic
1019689711 7:2403753-2403775 GGGGGTCCCGGGCCGCGCTGAGG + Intronic
1019711468 7:2519990-2520012 CAGCCTGGCGGGCCCCGCGGGGG + Exonic
1019828020 7:3300499-3300521 CAGGCTCCCGGGTCCCGCCCTGG + Intergenic
1020281658 7:6653173-6653195 CGTGTCCTCGGGCCCCGCGGCGG - Exonic
1022323616 7:29309849-29309871 CGGGCTCATGGGCCCTGCTGTGG + Intronic
1022721095 7:32942649-32942671 CGGCCTCCAGGGCCCCTCCGTGG + Intergenic
1023319304 7:38976075-38976097 GGGGCTCCCGGGCGCCCAGGAGG + Intergenic
1023418178 7:39950954-39950976 CGGCGTCGCGGGCCCCGCGCCGG + Exonic
1023983077 7:45080843-45080865 GGGGCTCCAGGGCCTCGCAGGGG - Intronic
1024579870 7:50793081-50793103 GGGGACGCCGGGCCCCGCGGAGG - Intronic
1026850360 7:73719722-73719744 CGGGGTCCCGGGGGCCGGGGCGG - Intergenic
1026968224 7:74453696-74453718 CGGGGACCTGGGCACCGCGGTGG - Intergenic
1029437315 7:100570452-100570474 CGGGCTTCCGGGGGCCTCGGGGG + Intergenic
1029506436 7:100966310-100966332 CGTGCACCTGGGCCCCGCGGGGG - Intronic
1029640766 7:101817449-101817471 CGGAGTCCCCGGCGCCGCGGGGG + Intronic
1033339187 7:140478952-140478974 AGGGCTCCGCGGCCCAGCGGGGG + Intronic
1034902100 7:154914224-154914246 CAGGCTCCGGTGCGCCGCGGGGG + Intergenic
1035169701 7:157010587-157010609 CGGGCTCCCGGGCCCGGACGCGG - Exonic
1035729847 8:1846144-1846166 CGGGAGCCCGGGAGCCGCGGAGG + Intronic
1036032697 8:4991637-4991659 CGCGCTCCAGGGCCCACCGGAGG - Intronic
1036344965 8:7955245-7955267 GGGGCATCCGGGCCCAGCGGGGG - Intergenic
1036787981 8:11700626-11700648 CCGGCGCCCAGGCCCAGCGGGGG + Intronic
1036803259 8:11808582-11808604 CGGGCCCCTGGGCGCCGCGGCGG - Intronic
1037547649 8:19939807-19939829 CGGGCTCGCAGGCTCCGCCGGGG + Intronic
1037820093 8:22131187-22131209 CAGGCGCCCGGGTGCCGCGGGGG - Exonic
1039554861 8:38468301-38468323 CGGGCTCCATCGCCCTGCGGAGG + Intronic
1039608391 8:38901113-38901135 CGGGCGCCGGGGCCGCGCGGGGG - Intergenic
1040555925 8:48477719-48477741 CGGGCTCCCTTGCCCCTCTGCGG + Intergenic
1044698835 8:94948970-94948992 TGGGCGGCCGGGCCCGGCGGCGG + Intronic
1045063763 8:98427946-98427968 CGGCCGCCCGCGCCGCGCGGGGG - Exonic
1046770354 8:118111665-118111687 CCGGCCCCCGGGACGCGCGGCGG + Exonic
1047259225 8:123241160-123241182 CCGGGGCCGGGGCCCCGCGGAGG + Intronic
1049792413 8:144478136-144478158 CGGACTCCCGGGTCCTGCGGCGG + Intronic
1051404890 9:16726882-16726904 CTGGCTCCTTGGCTCCGCGGGGG - Intronic
1053313536 9:37034580-37034602 CGGGCTCCCGGGCTCCGCTTCGG - Intergenic
1057488721 9:95506374-95506396 CGGGGGCGCGGGCGCCGCGGCGG + Intronic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1060114373 9:120928913-120928935 CGGGCGCCCCGGCCCCGCAGGGG - Intronic
1060700953 9:125748058-125748080 CGGCCACCCGGGCCCGGCGCGGG + Intronic
1062389641 9:136328779-136328801 CTGGCTCCTGGGCCCCACGCAGG + Intronic
1062472371 9:136712265-136712287 CGGGCTCCTGGGCGTCTCGGGGG - Intergenic
1062571739 9:137188935-137188957 CTGGCTCGCAGGCCCCGCGCCGG + Intronic
1062574532 9:137200158-137200180 GCCGCGCCCGGGCCCCGCGGTGG - Exonic
1062607115 9:137353333-137353355 CGGGCTCCTGGGACCCGGGGTGG - Intronic
1062656305 9:137605872-137605894 CGGGAGCCCTGGCCCCGCGCAGG - Intronic
1203471318 Un_GL000220v1:116508-116530 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1203479139 Un_GL000220v1:160480-160502 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1185643641 X:1601548-1601570 CGCGCTCCCGGTCCCCGAGCAGG + Exonic
1187257529 X:17656175-17656197 CGCGCCGCCGGGCCCCGCGCCGG - Intronic
1187332555 X:18354321-18354343 CGGGCGCCCAAACCCCGCGGCGG + Intronic
1190055727 X:47180072-47180094 CAGGGTCCCGGCCCCCGGGGTGG + Intronic
1190877480 X:54470293-54470315 CTGGCTCCTGGGCCCCGGGACGG - Exonic
1195269393 X:103215344-103215366 GCAGCCCCCGGGCCCCGCGGCGG + Intronic
1199772693 X:150984297-150984319 CGGGCCCCCGAGCCCCCGGGCGG + Intronic
1199881060 X:151974539-151974561 AGGGCTCCCGGGTCCCGGGATGG + Intronic
1200000234 X:153056373-153056395 CGGTCTCCCGGACGACGCGGAGG + Intergenic
1200065317 X:153501946-153501968 CGGGTTCCCGGGACCAGCTGTGG - Intronic
1200096336 X:153665857-153665879 CGGGCCCCCTGGCCAGGCGGTGG - Intergenic
1200115355 X:153767574-153767596 CCTGGGCCCGGGCCCCGCGGCGG - Exonic