ID: 1104602421

View in Genome Browser
Species Human (GRCh38)
Location 12:130162547-130162569
Sequence GCTGTGGGGGCGCCGCGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104602406_1104602421 15 Left 1104602406 12:130162509-130162531 CCGGCCGAGGCCGGCGCAGGGAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 198
1104602405_1104602421 16 Left 1104602405 12:130162508-130162530 CCCGGCCGAGGCCGGCGCAGGGA 0: 1
1: 0
2: 4
3: 29
4: 250
Right 1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 198
1104602409_1104602421 11 Left 1104602409 12:130162513-130162535 CCGAGGCCGGCGCAGGGAGGGAG 0: 1
1: 0
2: 3
3: 36
4: 352
Right 1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 198
1104602411_1104602421 5 Left 1104602411 12:130162519-130162541 CCGGCGCAGGGAGGGAGGAGCCG 0: 1
1: 1
2: 2
3: 40
4: 314
Right 1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 198
1104602401_1104602421 25 Left 1104602401 12:130162499-130162521 CCGGCTGGTCCCGGCCGAGGCCG 0: 1
1: 0
2: 0
3: 18
4: 154
Right 1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104602421 Original CRISPR GCTGTGGGGGCGCCGCGAGC TGG Exonic
900243394 1:1627186-1627208 GCTGCGGAGGCGCCCAGAGCAGG + Exonic
900243804 1:1628754-1628776 GCTGCGGTGGCGCCGGCAGCAGG + Intronic
900395878 1:2453049-2453071 ACTGAGGGGGCGCCCCGACCAGG - Intronic
900432061 1:2607132-2607154 ACTGTGGGGGCGCCGTTGGCCGG + Intronic
900591731 1:3463240-3463262 GCTGTGGGGGTGCCGGGACCTGG - Exonic
901211585 1:7529437-7529459 TCTGTGGGGGCTCAGCGAGCGGG - Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
903750319 1:25617166-25617188 GCGGAGAGGGCGCCGGGAGCTGG - Intergenic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
905912072 1:41662096-41662118 GCGGCGGGGGCGCGGCGCGCGGG + Intronic
907489685 1:54800971-54800993 GCTGCGGGGCGGCCGCCAGCTGG + Exonic
916144620 1:161727405-161727427 GCAGTCGGGGCGCCGCTCGCCGG - Exonic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
922566586 1:226605377-226605399 GCTGTGGGGGCGGCCCAACCTGG - Exonic
1066022858 10:31319872-31319894 GCTGTGGGCGCGCGGCAGGCGGG + Intronic
1066126264 10:32346386-32346408 GCTGTGGGGGTGCGGCGAGTCGG - Intronic
1067416369 10:46106292-46106314 GCTGGGGAGGTGCCGCTAGCGGG + Intergenic
1067848610 10:49741060-49741082 GGTGTGTGGGCGCTGCTAGCAGG - Intronic
1069594709 10:69663130-69663152 GCGGTGGGGGCGCTGCCACCAGG + Intergenic
1070407886 10:76112692-76112714 GCACTGGGGGCTCCGGGAGCCGG - Intronic
1072679834 10:97498781-97498803 GCGGCGCGGGCACCGCGAGCCGG + Intronic
1073403578 10:103277742-103277764 GCTGCGGGCGCGCTGCGAGGAGG + Exonic
1074088758 10:110227425-110227447 GCTGTGGGTGTGCGGCGAGCGGG + Intronic
1075057447 10:119230094-119230116 GTTGTGGGGGAGCAGGGAGCAGG + Intronic
1076480953 10:130785027-130785049 GCAGTGGGGGCGCCGGGAGCAGG - Intergenic
1076758439 10:132587522-132587544 GCTGTTGGGACGCGGGGAGCAGG + Intronic
1077052822 11:575489-575511 GCTGGGGAGGCGTCCCGAGCGGG - Intergenic
1077491500 11:2862916-2862938 GCGGTGGGGGCGGCGGGCGCGGG + Intergenic
1083762580 11:64826738-64826760 GCTGTGGGGCCGCTGTGGGCCGG + Exonic
1084429935 11:69105506-69105528 GCTGTGGGGGCACCCCGGGCCGG - Intergenic
1084673926 11:70623467-70623489 GCTGTGGGGGCGCAGCCTTCGGG - Intronic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1089582870 11:119492497-119492519 GCTCTGGGGGAGCAGCGAGCTGG - Intergenic
1090788575 11:130070356-130070378 GAGGTGGCGGCGCCGCGGGCGGG - Intronic
1092270332 12:7018507-7018529 GCCGTGGGCGGGCCCCGAGCCGG - Exonic
1094486073 12:30926819-30926841 GGAGTGGGGGCGCCGCGGGAGGG + Intronic
1097088562 12:56487766-56487788 GCTTTGGGTGCGCCGCGCTCGGG - Intronic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1104969683 12:132525607-132525629 GCTGTCGGGGCGCCTGGGGCCGG + Intronic
1105040310 12:132956125-132956147 GCGCTGGGGTCACCGCGAGCCGG + Intronic
1105409725 13:20161380-20161402 GCGGTGGGCGCCCCGCAAGCGGG - Intergenic
1105900063 13:24746005-24746027 GCTGTGGCGGAGGCGCGGGCTGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113467041 13:110520081-110520103 GCTGGGGGGGAGCCGTGTGCTGG + Intergenic
1113932035 13:113973779-113973801 GCTGTGGGGCCGCGGGGAGCGGG - Intergenic
1113949030 13:114060914-114060936 GCTGTGGGGGCTCCGTCTGCCGG - Intronic
1113949061 13:114061005-114061027 GCTGTGGGGGCTCCGTCTGCCGG - Intronic
1114554868 14:23556164-23556186 GTTGTGGCGGTGCCGAGAGCAGG - Exonic
1119306635 14:73612964-73612986 GCCGGGGGTGCGGCGCGAGCCGG + Intronic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122635395 14:103127333-103127355 GCTGTGGCGGCGCGGCGTGGCGG + Exonic
1122858245 14:104570336-104570358 GCCGTGGGGGCGCCTCGATGTGG - Intronic
1122905793 14:104800876-104800898 GCGTCGGGGACGCCGCGAGCGGG + Intronic
1122940487 14:104978855-104978877 GCGGGGTGGGCGCCGCGTGCGGG + Intergenic
1123112852 14:105881200-105881222 GCTCTGTGGGTGCCGCTAGCTGG - Intergenic
1125448450 15:39782903-39782925 GCTGTTGGAGCCCTGCGAGCTGG + Intergenic
1125664220 15:41417356-41417378 GCTGTCGGGGCCGCGGGAGCCGG + Intronic
1128109614 15:65068125-65068147 GCGGTGGGGGCGCGGCCGGCAGG - Intronic
1128322000 15:66701099-66701121 GGGGTGGGGCCGCCGCGCGCGGG + Intergenic
1129515293 15:76153594-76153616 GCTGTGGGGGAGGAGTGAGCAGG + Intronic
1131231932 15:90665747-90665769 GCTGTGGTGGGGCCGCGCACAGG - Intergenic
1132110806 15:99100599-99100621 GCTCTGGGGCCGCCTCGGGCGGG - Intronic
1132307880 15:100830798-100830820 GCTGTGGGGTGGCCGAGAACTGG + Intergenic
1132554080 16:565037-565059 GGCGTGGGGGCGGCCCGAGCTGG + Exonic
1132591880 16:729635-729657 CCTGTGTGGGCGCCGAGACCTGG + Exonic
1134070204 16:11255913-11255935 GCTGCGGGAGCCCCGCGCGCGGG + Intronic
1135517709 16:23149309-23149331 GCCGTGGCGGGGCCGCGGGCCGG - Intergenic
1136186331 16:28590911-28590933 GCTGTGGGGGCGCATGGATCAGG - Exonic
1136454046 16:30370346-30370368 GGTCGGGGGGCGCCGCGCGCCGG + Intergenic
1136774385 16:32863878-32863900 ACTGTGGGGGAGCCGCGTCCTGG - Intergenic
1136896226 16:33997636-33997658 ACTGTGGGGGAGCCGCGTCCTGG + Intergenic
1138419763 16:56891814-56891836 GCGGTGGGTGCGCCCTGAGCTGG - Intronic
1139409968 16:66751397-66751419 ACTGAGGGGCCGACGCGAGCCGG - Intronic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1141076033 16:81007215-81007237 GCTTTGAAGGCGCGGCGAGCGGG + Exonic
1142230339 16:88897129-88897151 GCTGTGGGGGCTCCGGGATCTGG + Intronic
1142374695 16:89701031-89701053 GCTGTGGGGCCGCGCCGACCTGG - Exonic
1142429728 16:90019529-90019551 GCTGGGGGGGCGCCGGGAGGGGG - Intronic
1203076812 16_KI270728v1_random:1126014-1126036 ACTGTGGGGGAGCCGCGTCCTGG - Intergenic
1143078782 17:4366371-4366393 GCTCTGGGGGCGGCTGGAGCGGG + Exonic
1144742388 17:17591374-17591396 GGGGTGGGGGAGCCGCGTGCGGG - Intronic
1144907771 17:18650348-18650370 GCTCTGGGAGCGCCCCGGGCGGG - Intronic
1147179044 17:38673610-38673632 GCGGAGGGGGCGCCGGCAGCCGG + Exonic
1147360599 17:39927397-39927419 GCTGGGGAGGCGCCCCGGGCTGG - Intronic
1147661836 17:42121086-42121108 GAAGTGGGGGGGCCGGGAGCGGG - Exonic
1148126914 17:45241932-45241954 CCTGTGGGGGCGCAGAGGGCGGG - Exonic
1148809010 17:50278714-50278736 GCAGTGTGGGCGGCGGGAGCGGG + Intronic
1148820557 17:50357207-50357229 GCTGTTGGGGCGCAGTGACCAGG + Exonic
1149614711 17:57988147-57988169 GCTGAGGAGGCTCCCCGAGCGGG - Exonic
1151370841 17:73645222-73645244 GCTGCGGGGGCAGCGTGAGCCGG + Intergenic
1151396284 17:73825216-73825238 GCTGTGGGGGCTGCCTGAGCAGG - Intergenic
1151469534 17:74309506-74309528 TCTGTGGGGGAGCCGTGTGCAGG + Intronic
1152111622 17:78360228-78360250 GCCGAGGGCGGGCCGCGAGCAGG + Intergenic
1152554667 17:81046893-81046915 GCTGTGGTGGCACAGCGGGCTGG + Intronic
1160703689 19:519455-519477 GCTGGGGGGTCCCCGCGTGCGGG + Exonic
1160865485 19:1254112-1254134 GGGCTGGGGGCGCCGCAAGCTGG + Intronic
1161028204 19:2046327-2046349 GCATTGGGGGAGCCGGGAGCGGG - Intronic
1161120803 19:2525204-2525226 GCTGTGGGAGGGGCGGGAGCAGG + Intronic
1161482245 19:4516990-4517012 GCGGTGGGGGCGGGGCGGGCTGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163453274 19:17391341-17391363 CCTCTGGGGGCGCAGGGAGCCGG + Intergenic
1163651446 19:18520700-18520722 GGTGGGGGGGTGCCGCGGGCGGG - Intronic
1163666588 19:18606553-18606575 GTCCTCGGGGCGCCGCGAGCCGG - Exonic
1163756646 19:19110524-19110546 GCCGTGAAGGCGCCGCGAGGGGG - Intronic
1166114148 19:40642455-40642477 TCTGTGGGGGAGCAGCGGGCAGG + Intergenic
1166390699 19:42407393-42407415 GCTGTGGCCGCGCCCCCAGCAGG - Exonic
1166822990 19:45591911-45591933 GCTGTGGGGCCACAGGGAGCGGG + Exonic
1166876537 19:45901385-45901407 GGTGTGGCGGCGCCGGGGGCAGG - Exonic
1167435963 19:49478898-49478920 GCTGGGGGGGGGCTGGGAGCAGG - Exonic
1167562265 19:50232923-50232945 GCTGTGGGAGGGCTGGGAGCAGG + Intronic
1167738669 19:51311684-51311706 GCTGGGGGGGCGCGACGAGGCGG - Intergenic
926220963 2:10935194-10935216 GCTGTGGGGGAGGCGGGATCTGG + Intergenic
928904813 2:36356940-36356962 GAGGTGGGGGCGCCGCGGGCGGG + Intronic
934113839 2:88765705-88765727 GCTGCGGAGGCGCAGCGGGCTGG - Intergenic
934665221 2:96164763-96164785 GCTCTGGGAGCGCCGCCACCAGG - Intergenic
935593818 2:104864166-104864188 GGTGTGCGGGCGCCGGCAGCAGG + Intergenic
940775169 2:157876616-157876638 GCTATGAGCGCGCCGCCAGCGGG + Intergenic
943906191 2:193502912-193502934 GCAGAGGAGGCGCCGAGAGCGGG + Intergenic
946688799 2:222295703-222295725 GCGGTGGGGCCGCCGCCACCTGG - Intronic
946747589 2:222861274-222861296 GTTGTGGGAGCGGCGGGAGCCGG + Intronic
948478137 2:238234471-238234493 GTTCGGGGGGCGCCGTGAGCTGG - Intergenic
948591267 2:239052278-239052300 GCAGTGCTGGCACCGCGAGCTGG - Exonic
1170554407 20:17504144-17504166 GCTGTGGGGGCGCCCAGGACAGG - Intronic
1171032942 20:21693207-21693229 GATGTGGTGGCGCGGAGAGCAGG - Intergenic
1172890553 20:38260852-38260874 GCGGTGGGGGCGGGGCGCGCGGG - Intronic
1173182461 20:40815416-40815438 GATCTGGGGGTGCAGCGAGCTGG - Intergenic
1173728377 20:45312298-45312320 GCTGCGCGGGGGCCGGGAGCTGG + Exonic
1173750038 20:45469639-45469661 GCTTTGCGGGCACCGCGGGCGGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1176173826 20:63708349-63708371 GCCGTGGGCTCGCCGCTAGCCGG - Intronic
1176205818 20:63887616-63887638 GCTCTGGAGCCGCAGCGAGCAGG - Intronic
1180189017 21:46153919-46153941 GCTGTGGGAGCGTGGCGACCTGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181053074 22:20246768-20246790 GCTGTGGAGGCGCCGAGCACCGG + Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181670668 22:24424223-24424245 GCAGTTGCGGCGCCGCGTGCGGG + Intronic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1184207605 22:43014966-43014988 ACGGTTGGGGCGCCGCGGGCGGG - Intronic
1185086332 22:48742896-48742918 ACTGTGGGGGCCCCGCGTGTGGG - Intronic
1185171230 22:49295808-49295830 GCTGATGGGGCGGCGCAAGCCGG + Intergenic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1185368219 22:50446612-50446634 GCTCTGGGGGCGGATCGAGCAGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950940368 3:16885053-16885075 GCCGGGGGGGCGCCGCCGGCGGG + Intronic
950994339 3:17479806-17479828 GCAGTGGGGGAGGCGCTAGCTGG + Intronic
954439234 3:50512469-50512491 GCTGTGGGGTGGCTGGGAGCAGG + Intergenic
954468869 3:50674948-50674970 GCCGCGGCGGCGCCGGGAGCCGG + Intergenic
954715257 3:52523732-52523754 GCTGTGGGGGTGCCAGGAGGGGG - Exonic
955228557 3:57079713-57079735 GGGGTGGGGGCGCCGCGTGCAGG - Intergenic
955318644 3:57959020-57959042 CCTGTGGGGGCGCCATGAGAAGG + Intergenic
955769524 3:62373734-62373756 CCTTTGGGGGCGCCGCGTCCGGG - Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
967754863 3:193157245-193157267 GCTGAGGAGGCTCCCCGAGCGGG - Intergenic
967923400 3:194629363-194629385 GCTGTGGGGGCGCTGAGGGAGGG - Intronic
968084267 3:195867533-195867555 GCCGTGGGGGCGGCGGGGGCTGG + Exonic
968688447 4:1976973-1976995 GCTGTGGGGGCGGGGCGGCCAGG + Intronic
968978881 4:3836187-3836209 GCTGTGGGCCCGCTGGGAGCCGG - Intergenic
969315895 4:6381183-6381205 GCTGTGGGGCCTCGGGGAGCGGG - Intronic
969716648 4:8871267-8871289 GCTGCGGAGGCGCAGCGCGCTGG - Exonic
969873152 4:10116886-10116908 GCTGGGGGCGAGCCGCGCGCGGG - Intronic
978361105 4:107931793-107931815 GCTGCGGAGGCGCCGGGCGCGGG + Exonic
982291813 4:153789312-153789334 ACTGTGGGGGCGCAGCGGCCAGG - Intergenic
985129727 4:186727005-186727027 GCCGGAGGGGCTCCGCGAGCCGG - Intergenic
985163110 4:187064170-187064192 GCTGTGGGAGCGGAGCGAGCAGG + Intergenic
985574298 5:666421-666443 GCTGTGGTGGCCCCGGGAGGAGG - Intronic
989613008 5:43313302-43313324 GCTGCGGAGGTGCCGCGGGCGGG - Intronic
990910074 5:60843985-60844007 GGTGCGGGGGCCCCGGGAGCGGG - Intronic
998228895 5:140346706-140346728 GCGCTGCCGGCGCCGCGAGCCGG - Intergenic
999248272 5:150166978-150167000 ACTGCGGGGGCGCCGGGGGCGGG - Exonic
1002052284 5:176577822-176577844 GCTGTGGGGTCCCAGCAAGCGGG + Intronic
1002091832 5:176810648-176810670 GCCCCGGGGGCGCCCCGAGCTGG + Exonic
1002277488 5:178113496-178113518 GCTGTGGGCTTGCCGCGCGCCGG + Exonic
1002575132 5:180170110-180170132 GCTGGGGTGCAGCCGCGAGCAGG - Intronic
1002898001 6:1390183-1390205 GCGGCGCGGGCGCCGGGAGCGGG + Exonic
1003175858 6:3751856-3751878 GCGGCGGGGGCGCGGCCAGCCGG - Exonic
1015786077 6:136922437-136922459 GCTGTGCCGGGGCCGCGTGCTGG + Exonic
1016428546 6:143959148-143959170 GCTGGGGAGGAGCTGCGAGCAGG - Intronic
1018247810 6:161839278-161839300 GCTGAGGGAGCGCCTGGAGCTGG + Intronic
1019501536 7:1367220-1367242 GATGTGGGGGCCCCGGGGGCAGG - Intergenic
1019730090 7:2624738-2624760 GCTCTGGGGGTGCCGGGAGCCGG - Intergenic
1022427885 7:30285313-30285335 GCTCTCGGGGCGCAGCGCGCGGG + Exonic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026909364 7:74083624-74083646 GGCCTGGGGGCGCCGCGAGCTGG - Intronic
1029139789 7:98401331-98401353 GCTCTGGGAGAGCCGCGAGGGGG - Intergenic
1029270585 7:99374788-99374810 GCCGTGGGGGCGCCCGGAGGTGG + Intronic
1032128657 7:129212136-129212158 GCTCAGGGGGCGGCGCCAGCGGG - Exonic
1032554706 7:132819837-132819859 GCTGCGGGGGCAGCGTGAGCCGG + Intronic
1034347652 7:150397210-150397232 GCCGCGGGGGCGCCCCGAGTGGG + Exonic
1037390515 8:18387248-18387270 GCGGCGGCGGCGCCGCCAGCGGG - Intergenic
1039311365 8:36321406-36321428 GCAGGGGGGGCCCCGCCAGCTGG + Intergenic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1041028600 8:53712505-53712527 GTTGGGGCGGCGCGGCGAGCGGG + Intergenic
1041753581 8:61288320-61288342 GCTGAGCGGGCGCCGGGAGGAGG - Intronic
1048990686 8:139758512-139758534 GCTGTGGGGAGGCCGGGGGCAGG + Intronic
1049038048 8:140091931-140091953 GCTGTGGGGCCGGCGGGAGATGG - Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049418262 8:142505375-142505397 CCTGTGGGGGCTGCCCGAGCAGG + Intronic
1049944586 9:581260-581282 CCAGAGGGGGCGCCGAGAGCAGG + Intronic
1051079628 9:13279400-13279422 CCTGGGCGGGCGCCGCGAGCCGG - Exonic
1052494680 9:29212306-29212328 GGTGTGGGGGCGCCAGGAGGCGG - Intergenic
1056643286 9:88388663-88388685 GCTATGCGGGCGCCGCCCGCTGG - Intronic
1056643486 9:88389214-88389236 TCCGTGGGGGCGCGGCGAACGGG + Intronic
1060468723 9:123930129-123930151 GCGGAGGGGGCGGCGCGCGCCGG - Intronic
1060481199 9:124017749-124017771 GCCGTCGGGGCGCCGGGCGCTGG + Intronic
1060583436 9:124771286-124771308 GCTGAGGGGGCGCGGCGCGGAGG - Intronic
1060849199 9:126860691-126860713 GCGGAGGGGGCGCCGCGGGCGGG + Intronic
1060979669 9:127785255-127785277 TCTGTGGGGGCACTCCGAGCCGG + Intergenic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1061700201 9:132410086-132410108 GATGAGGGGCCGGCGCGAGCGGG + Intronic
1062204084 9:135326164-135326186 GCTGTGGGGCCGCAGCCTGCTGG + Intergenic
1062577261 9:137214525-137214547 GCTGTGGGGACGCCGCAGGGAGG - Intronic
1187181462 X:16946992-16947014 GCTGTGCCGGCGCCGCGGGCGGG + Exonic
1188537364 X:31212449-31212471 GCGGTTGGGGGGCGGCGAGCAGG + Intronic
1195156063 X:102125738-102125760 GCGGCGGGGGAGCAGCGAGCGGG + Exonic
1195158053 X:102142399-102142421 GCGGCGGGGGAGCAGCGAGCGGG - Exonic
1195308404 X:103607990-103608012 GCAGCGGGGGAGCAGCGAGCGGG + Intronic
1200105568 X:153710178-153710200 ACTGTGGGGGAGCCGCGTCCTGG + Intronic