ID: 1104602448

View in Genome Browser
Species Human (GRCh38)
Location 12:130162666-130162688
Sequence CTCGCGCCGGGCCGCTGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104602439_1104602448 27 Left 1104602439 12:130162616-130162638 CCTGGGCGCTCCAAGAAGAGGCC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124
1104602437_1104602448 30 Left 1104602437 12:130162613-130162635 CCACCTGGGCGCTCCAAGAAGAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124
1104602440_1104602448 17 Left 1104602440 12:130162626-130162648 CCAAGAAGAGGCCGAAGTTTGCC 0: 1
1: 0
2: 0
3: 7
4: 46
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124
1104602442_1104602448 6 Left 1104602442 12:130162637-130162659 CCGAAGTTTGCCGCGGCCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124
1104602444_1104602448 -4 Left 1104602444 12:130162647-130162669 CCGCGGCCGTGAGTTGGAGCTCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124
1104602445_1104602448 -10 Left 1104602445 12:130162653-130162675 CCGTGAGTTGGAGCTCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104602448 Original CRISPR CTCGCGCCGGGCCGCTGCGC CGG Exonic
901434013 1:9235117-9235139 CTCGGGCCCGGCGGCAGCGCGGG - Intronic
903875874 1:26472726-26472748 CCCGCGCGGGGAGGCTGCGCTGG - Intronic
905126448 1:35718939-35718961 CCCGCGCCAGGCCCCTGCGCCGG + Exonic
906650399 1:47508626-47508648 CCCCCGCCGGGGGGCTGCGCTGG + Intergenic
907689202 1:56645490-56645512 CGCGCTCCGGACCGCTGTGCGGG + Intronic
911725288 1:101236370-101236392 CACTCGCCGGGCCGCGGCTCAGG + Intergenic
922416555 1:225427851-225427873 CCCCGGCCCGGCCGCTGCGCCGG + Intronic
922472933 1:225887850-225887872 CCCGGGCCCGGGCGCTGCGCGGG + Exonic
922480938 1:225939820-225939842 CCCGGGCCTGGGCGCTGCGCGGG + Exonic
922648614 1:227318111-227318133 CCCGCACCGGGCCGCCGCGCCGG + Exonic
923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG + Exonic
924539761 1:244970335-244970357 CTCGCCGCGGGGCGCTGAGCAGG + Exonic
924615074 1:245605850-245605872 CTCGCCCCCGGCCTCTGCACGGG + Intronic
1063393685 10:5666603-5666625 GCCGCGCGGGGCCGCTGGGCGGG + Intergenic
1065099615 10:22320909-22320931 CTCGCTCCGCGCCGCGGCGGCGG - Intronic
1068461629 10:57336999-57337021 CTAGTGCGGGGCCGCTGAGCGGG + Intergenic
1069942368 10:71964438-71964460 CTCTCGCAGGCTCGCTGCGCAGG + Exonic
1071997529 10:91162911-91162933 CTCGCGCCCGCCCGCCGGGCCGG + Intergenic
1072994278 10:100229498-100229520 CCCGCGCCCGGCCGCAGCCCCGG + Exonic
1083904896 11:65662986-65663008 CTTGCTCCCGGCCCCTGCGCCGG - Exonic
1083997227 11:66278430-66278452 CCCGCGCCGGGCGGCGGCCCGGG - Exonic
1088325124 11:108593319-108593341 CTCGCGCGGGGCACCTGCCCGGG - Intronic
1088401066 11:109422951-109422973 CCCACTCCGGGCCGCCGCGCGGG - Intronic
1089243024 11:117098117-117098139 CTGCCGCCTGGCCCCTGCGCCGG + Intronic
1089273205 11:117315687-117315709 CGCCCCCCAGGCCGCTGCGCAGG + Exonic
1089525662 11:119094935-119094957 CTGGCGGCCGGCCGCGGCGCGGG + Exonic
1090699276 11:129279522-129279544 CACGCGCCGGCCAGCTGGGCGGG - Intergenic
1091588262 12:1828152-1828174 CTGGCGCCGGGCAGCAGCCCTGG + Exonic
1094107921 12:26833169-26833191 CTCCCGCCGGGCGGCTGTGACGG - Exonic
1096498952 12:52054104-52054126 CTCATGCTGGGCCGCTGCCCAGG + Intronic
1100309232 12:93378486-93378508 CTCGCTCCCCGCCCCTGCGCAGG + Intronic
1100632214 12:96400263-96400285 CTCGCGCCCGGCTGCTCCGAGGG - Exonic
1101466916 12:104958339-104958361 CTTGCGCGGGGCTGCCGCGCGGG - Intronic
1102101587 12:110282034-110282056 CTCCCGCGGGGCCGGCGCGCTGG - Intronic
1102310646 12:111842204-111842226 CCCGCGCCGGGCAGCCCCGCCGG - Intronic
1103722101 12:122980656-122980678 TTCCGGCCGGGGCGCTGCGCGGG - Exonic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1108542061 13:51453621-51453643 CTCGCGCCGGGGCGGCGCGCCGG - Intronic
1121617012 14:95319984-95320006 CTCGCGCCAGCCCGCGGCGGGGG - Intergenic
1121690964 14:95876863-95876885 CTCCCGCCGAGCCCCGGCGCGGG + Intergenic
1122270776 14:100567703-100567725 CTCGCGCGGGGCTCCTCCGCCGG - Intronic
1122418382 14:101560998-101561020 CTCGTGCGGGGCCGCTGCCCAGG - Intergenic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1122993294 14:105248969-105248991 CTGGCGCGGGGGCGCTGGGCGGG - Exonic
1123021063 14:105398250-105398272 CGCGCGCGGGGCCGCAGGGCTGG - Intergenic
1129541114 15:76347384-76347406 CTCGAGCCGGAGCGCCGCGCTGG + Intergenic
1133998016 16:10762476-10762498 CTCGCCGCGGGGCGCTGGGCAGG + Intronic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1136385982 16:29926211-29926233 CCGGCGCCGGGCAGCTGCGCAGG + Exonic
1138550189 16:57743651-57743673 CTCACCCCGGGCCCCTGCCCTGG + Intronic
1140097093 16:71884245-71884267 CGCGCGCCGGGCCGCGGGGAAGG - Intronic
1141699956 16:85637863-85637885 CTGGCTGCGGGCCGCTGAGCTGG - Intronic
1142110429 16:88328158-88328180 CTCGCCCGGGGCTGCTGTGCAGG + Intergenic
1142980381 17:3668065-3668087 CTCCCTCCGGGCGGCGGCGCAGG + Intronic
1143030381 17:3964194-3964216 CGCGCGCCGGTCACCTGCGCCGG + Exonic
1143503129 17:7350368-7350390 CTCGAGCCTGGCCCCGGCGCTGG - Intronic
1143723963 17:8832888-8832910 CCCGCGGCGGGGCGCTGCGGTGG - Exonic
1144849645 17:18237596-18237618 CACGCACGGGGCCGCTGCCCTGG + Exonic
1146095835 17:29929830-29929852 CACGCGCCGCGCCGCTTCCCAGG - Intronic
1146271371 17:31487967-31487989 CTCGCGCCGGGGCGGGGCGGGGG - Intronic
1146339671 17:32007857-32007879 CCCCCGCCGGGCCCGTGCGCTGG - Intronic
1146355175 17:32127529-32127551 CTCAGGCAGGGCCACTGCGCAGG + Intergenic
1148081058 17:44967921-44967943 CCCGCGCGGGGCCCCGGCGCCGG - Exonic
1148156904 17:45429868-45429890 CGGGCGCCAGGCTGCTGCGCTGG + Intronic
1148680328 17:49470079-49470101 CTCGCCCCGGGAAGCTGCGGTGG - Intronic
1150388609 17:64778642-64778664 CGGGCGCCAGGCTGCTGCGCTGG + Intergenic
1150388612 17:64778665-64778687 CTCGCGGCGCCGCGCTGCGCAGG + Intergenic
1150488922 17:65561361-65561383 GTCGCGCCGAGCCGCGGCGTGGG - Intronic
1150790857 17:68199348-68199370 CGGGCGCCAGGCTGCTGCGCTGG - Intergenic
1151660770 17:75516838-75516860 CTCAGGCCGAGCGGCTGCGCCGG + Exonic
1152245558 17:79183076-79183098 CCCGCGCTCGGCCGCCGCGCAGG + Intronic
1152758935 17:82098400-82098422 CCCGAGCCGGGACCCTGCGCGGG + Intergenic
1153457353 18:5295645-5295667 CTCGCACCGCGCCGCGCCGCTGG + Intronic
1154210773 18:12377101-12377123 CTCGGCCCGGGACGCTGCGCAGG + Exonic
1156099745 18:33578740-33578762 CCCGCGCCGGTCCGCGGCGGCGG + Intronic
1160163117 18:76490970-76490992 CTCGCGAGGGGCTGCTGCGTGGG - Intronic
1160701134 19:507929-507951 CAAGCCCCGGGCCCCTGCGCCGG - Intronic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
1160919539 19:1513249-1513271 CTCGGGCGGGGGCGCGGCGCGGG + Intronic
1161684737 19:5697171-5697193 CGCGGGCCGGGCCCCTGTGCTGG - Intronic
1162799859 19:13104438-13104460 CTCGCCCCGGGCCTCAGGGCAGG + Intergenic
1166097396 19:40549420-40549442 CCCGCCCCAGGCCCCTGCGCTGG - Intronic
1166366635 19:42281345-42281367 CTCGCCCCAGGCCTCTGGGCAGG + Intronic
1167101609 19:47407311-47407333 CTCGCCCCGGGCCGGCCCGCGGG + Intronic
928313733 2:30231102-30231124 CTGGCGCCGGGCGGCTGGGGTGG + Intergenic
929033878 2:37672530-37672552 GGCGCGCCGGGCGGCGGCGCTGG - Intronic
929681288 2:43995798-43995820 CTCGCGCCGGGCCCGTGGCCGGG - Exonic
930751625 2:54939895-54939917 CTTGTGCCGGGCCGCTGAGATGG - Intronic
931602513 2:64018947-64018969 CTCGCTCAGGGCGGCTGCCCCGG - Exonic
935371830 2:102355800-102355822 CCCGCGCCGCGCGGCTGGGCAGG + Intronic
937369005 2:121284997-121285019 CTCGGGCCGGGCCGGCGGGCCGG - Intronic
939629745 2:144517117-144517139 CGCGCGCCGGGCTCCGGCGCCGG + Intronic
941772767 2:169362199-169362221 CTAGGGCCGGGCGGCGGCGCGGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1174645870 20:52084959-52084981 CACGCGCAGGGCGGCCGCGCTGG + Intronic
1180960101 22:19758679-19758701 CCTGCGCCCGGCCGGTGCGCAGG + Intronic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
1183788508 22:40045546-40045568 CACAGGCCGGGACGCTGCGCAGG - Intronic
1185088060 22:48751312-48751334 GTCGCGCCGGGCAGAGGCGCAGG + Intronic
950510043 3:13420430-13420452 CTCGCGCAGGGACGCGGGGCTGG + Intergenic
950911876 3:16604511-16604533 CTCGCGCCTGTCAGCTGCGGGGG - Exonic
954367704 3:50155172-50155194 CCCGGGCCGGGCGGCCGCGCTGG - Exonic
955977040 3:64489505-64489527 CTCGCCCTGGGCCGCTCCGAAGG - Intergenic
961536455 3:127573689-127573711 CTCCCGCCGGGCCACAGCGTAGG + Exonic
961603403 3:128077069-128077091 ATCGCGCCGGGCCCCTGCCCGGG + Intronic
966732520 3:183162779-183162801 CCCGCCCAGGGCCGCTGGGCGGG + Exonic
983296479 4:165874103-165874125 CGCGCCGGGGGCCGCTGCGCTGG + Intronic
984639354 4:182144802-182144824 CTAGTGCCGGGCCGCGGCGCCGG + Intronic
984952870 4:185019705-185019727 CAGGCGCTGGGCCGCTGCGAGGG + Exonic
985894982 5:2743521-2743543 CGGGCGCCGGGCCGCGGAGCCGG + Intergenic
997470629 5:134115127-134115149 CTCGCCGCGGGCCCCGGCGCCGG - Exonic
998266705 5:140672466-140672488 CTCGCACCGGGCCGCTGCCATGG - Exonic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1005048524 6:21664476-21664498 CACGCGCAGGGCCGCGGCTCTGG - Intergenic
1005569821 6:27133893-27133915 GTCGCGCAGGGCCACTGTGCCGG - Exonic
1005649333 6:27872163-27872185 CTCGCGCAGGGCCACGGTGCCGG + Exonic
1005886385 6:30100941-30100963 CACGCGCCGGGCAGCAGCGTGGG + Intergenic
1006642643 6:35496920-35496942 CTCCGGCCGGGCCGCTCCGCCGG + Exonic
1007576738 6:42929848-42929870 CTTGCGCCGGGACGCTGCGGCGG + Intronic
1017793636 6:157823069-157823091 CCCGCGCCGCGCCGCCGCCCCGG - Intronic
1024919392 7:54542229-54542251 CTCGCGCCGGGCGGCCGCGGAGG - Intergenic
1024965466 7:55019441-55019463 CGGGCGCCGAGCCGGTGCGCCGG - Intronic
1029537247 7:101163883-101163905 CACGCGGCAGGCCGCGGCGCAGG - Exonic
1031406913 7:121396538-121396560 CCGGCGCAGGGCCGCTGCGGCGG - Intergenic
1037879246 8:22565158-22565180 CTTACGCCGGCCCGGTGCGCTGG + Intronic
1040079385 8:43271979-43272001 CTTGGCCCGGGACGCTGCGCAGG + Intergenic
1049687745 8:143945741-143945763 CTGGCCCCGGGCCACTGGGCAGG + Intronic
1049776720 8:144409384-144409406 CTCACGCGGCGGCGCTGCGCAGG - Intergenic
1049814323 8:144591111-144591133 CTGGAGCCGGGTGGCTGCGCAGG + Intronic
1057773351 9:97985072-97985094 CCCGCGCCGGTCCGCGGCGGGGG - Intronic
1060554982 9:124503554-124503576 CCCACCCCGGGACGCTGCGCGGG - Intronic
1061038735 9:128127728-128127750 CGCGCGCCCGCCCGCGGCGCCGG - Exonic
1061840583 9:133356560-133356582 CTTCCGCCGGGCTGCTCCGCGGG + Exonic
1062499341 9:136845596-136845618 CCCAGGCCGGGCTGCTGCGCGGG - Exonic
1062584002 9:137240870-137240892 CGGGCGGCGGGCAGCTGCGCTGG - Intergenic
1062658962 9:137618577-137618599 CCCGCGCCAGGCCGCGGCCCAGG + Exonic
1203759079 EBV:2700-2722 TTGGCGCCGGGCCGCCGCCCTGG - Intergenic
1187163877 X:16787021-16787043 CTGGCGTCGGGCAGGTGCGCAGG + Intronic
1198214603 X:134545082-134545104 CTTGCGCCGGGGCAGTGCGCGGG - Intergenic
1200086506 X:153609871-153609893 CTCGCGGCGGCCCGCTGCCCCGG - Intergenic