ID: 1104603407

View in Genome Browser
Species Human (GRCh38)
Location 12:130169137-130169159
Sequence CAGTGGGGCTAGGGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 440}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104603397_1104603407 10 Left 1104603397 12:130169104-130169126 CCTGCATTTTTGCAGCAGTCGCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG 0: 1
1: 0
2: 4
3: 49
4: 440
1104603396_1104603407 19 Left 1104603396 12:130169095-130169117 CCGTGGCAACCTGCATTTTTGCA 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG 0: 1
1: 0
2: 4
3: 49
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104603407 Original CRISPR CAGTGGGGCTAGGGGGAAGC AGG Intergenic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901501069 1:9652803-9652825 GGGTGGGGCGAGGGTGAAGCAGG + Exonic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
903330647 1:22595376-22595398 CGGTGGGGCTGGGGGCAGGCAGG - Intronic
904001569 1:27341896-27341918 CAGTGGAGCTGGGGCCAAGCTGG + Intergenic
904580720 1:31541855-31541877 GAGTGGGTCTAGGGGCAACCAGG - Intergenic
905346658 1:37315695-37315717 CATTGGGGGTTGGGGAAAGCTGG + Intergenic
906519906 1:46460859-46460881 CAGTGGGGTTTGGAGGAATCGGG - Intergenic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908408234 1:63836101-63836123 CAGTGGGGCTATTGGGAGGAAGG - Intronic
909817466 1:80014402-80014424 CATTGGAGCTAGGGGTAAGTGGG - Intergenic
910330315 1:86065864-86065886 CAGTGGGGGTAGGAGGGAGCTGG + Intronic
910333308 1:86100700-86100722 CAGAGGGGGTAGGGGAAAGTAGG - Intronic
910443956 1:87281890-87281912 CAGTGTGGCTAGGATAAAGCAGG + Intergenic
911164632 1:94713797-94713819 GAGTGGGGCTATGGAGAATCAGG + Intergenic
911575665 1:99574417-99574439 ATGTGGGGCTAGGGAGAAGTGGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912417579 1:109520496-109520518 CAGTGGGGCCAAGGGGTAGCTGG + Intergenic
912450069 1:109763278-109763300 CAATGGGGGTTGGGGGAGGCTGG - Intronic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
914450638 1:147788335-147788357 CAGATGGGTCAGGGGGAAGCAGG + Intergenic
915121435 1:153631901-153631923 AAGTGGGGTGAGGTGGAAGCAGG - Exonic
915461488 1:156073151-156073173 CAGTTAGGCCTGGGGGAAGCAGG + Exonic
915517159 1:156420309-156420331 CAGAGGGGCCCGGGGAAAGCCGG - Intronic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917675352 1:177313644-177313666 CAGTGGGGATAAGTGGAAGTTGG + Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920565452 1:206969289-206969311 CCGTGGGGCAATGAGGAAGCAGG + Intronic
922188437 1:223296370-223296392 GAGTGGGCCTAGGGAGAAGGGGG + Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
923108145 1:230869430-230869452 GAGAGGGGCTTGGGGGAAGTGGG - Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923273719 1:232379283-232379305 CACTGGGGAGAGGGGGTAGCGGG + Intergenic
923303241 1:232663030-232663052 GTGTGGGGCTCAGGGGAAGCAGG + Intergenic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923719416 1:236454433-236454455 CATGGGGGCTAGGAGGAAGGAGG - Intronic
924009776 1:239652218-239652240 CAGTAGGGCTAGGGAGTTGCAGG - Intronic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
924258628 1:242207291-242207313 CAGTGGGGAAAGCGGGGAGCGGG - Intronic
1062857079 10:784762-784784 CAGAGGGGCCAGCGGGGAGCCGG - Intergenic
1063113544 10:3056902-3056924 CAGTGGGATTAGCAGGAAGCGGG + Intergenic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063489268 10:6448045-6448067 CAGGTGGAGTAGGGGGAAGCTGG + Intronic
1063599410 10:7466705-7466727 GAATGGGGCTTGGGGGAAGACGG - Intergenic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1066395959 10:35021913-35021935 AAGTGGGGCGAGGGGGCACCCGG + Intronic
1066546201 10:36503131-36503153 CAAGGGGGCCAGGAGGAAGCAGG - Intergenic
1067437361 10:46287443-46287465 CACTGGCGCCAGGGGCAAGCAGG + Exonic
1067719666 10:48718521-48718543 GGGTGGTGCTAGGTGGAAGCGGG + Intronic
1067836245 10:49643624-49643646 GAGTGGGGGTAGGGTGAGGCTGG - Intronic
1068876267 10:61999934-61999956 AAGTGGGGCTGGGAGGATGCTGG + Intronic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070409363 10:76125250-76125272 GTGGAGGGCTAGGGGGAAGCTGG + Intronic
1070483198 10:76905367-76905389 CAGTGGCATTAGGAGGAAGCTGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1072591852 10:96833510-96833532 GACTGGGGCTAGGGGGCGGCGGG - Intronic
1072923438 10:99595894-99595916 CTGAAGGGGTAGGGGGAAGCAGG + Intergenic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075854960 10:125621903-125621925 CAGTGCGGCTAGAACGAAGCAGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076402470 10:130193061-130193083 GAGTGGGGCTTTGGAGAAGCAGG - Intergenic
1076456325 10:130601157-130601179 TAGTGGGGCTTGGGGGCAGGTGG - Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076802207 10:132835935-132835957 GAGTGGGGGGAGGGGGGAGCAGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077219042 11:1407318-1407340 CAGAGGGCATAGGGGGCAGCAGG - Intronic
1077330669 11:1982630-1982652 CCCTGGGGCTTGGGGAAAGCCGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079922529 11:26450403-26450425 CAATAGGGCTAGGGAGAAGCAGG + Intronic
1080488647 11:32737820-32737842 GAGTGGGGTTAGGGGTGAGCTGG - Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1082006541 11:47422520-47422542 CTGTGGCGGTAAGGGGAAGCGGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083997182 11:66278337-66278359 CCGTGGGGCTCGGGGGACGTGGG - Exonic
1084004361 11:66315266-66315288 CAGTTGGGATAATGGGAAGCTGG + Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086325577 11:85695379-85695401 CATTGGGGGTAGGGGAAAGAGGG + Intronic
1086989547 11:93287990-93288012 CAGTGGGTCTAGGGAACAGCTGG + Intergenic
1087111629 11:94475963-94475985 CCTTTGGGATAGGGGGAAGCAGG + Intronic
1087128400 11:94648116-94648138 CAATGGGGATTTGGGGAAGCAGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1088106539 11:106212830-106212852 CAGAGAGGCTACAGGGAAGCAGG + Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089348413 11:117807070-117807092 GCGTGTGGCTTGGGGGAAGCGGG - Intronic
1089880474 11:121768594-121768616 CAGTGTGGCTAGGATAAAGCAGG - Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090363597 11:126189317-126189339 CAGTGGGGCCAGGTGACAGCTGG - Intergenic
1202813647 11_KI270721v1_random:37809-37831 CCCTGGGGCTTGGGGAAAGCCGG - Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1092104528 12:5912193-5912215 CAGTGGGTCTAGTGAAAAGCAGG - Intronic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092219752 12:6704951-6704973 CAGTGGGGCTAAGGGTGTGCTGG - Intergenic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1100309074 12:93377858-93377880 CAGTGGCGCGCGGGGGAGGCGGG + Intergenic
1101662140 12:106775003-106775025 CAGTGGGGGTAGTGGGATGCAGG - Intronic
1101813297 12:108126485-108126507 CAGATGGGCTGGGGGGATGCTGG + Intergenic
1102207617 12:111101195-111101217 CAGTGCGGCCCGGGGGAGGCTGG + Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102699189 12:114824254-114824276 AAGTGGCGGTAGGGGGAAGCTGG + Intergenic
1102776560 12:115524814-115524836 CAGTGGGGCTAACTGGAAGGAGG - Intergenic
1103910654 12:124350212-124350234 CAGTGGGGCGAGGGGCACTCTGG + Intronic
1104051153 12:125194695-125194717 CAGTGGGGTTGGGGGGCACCTGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1105443488 13:20434172-20434194 GAGAGGGGCTAGGGAGAGGCAGG - Intronic
1107821378 13:44288769-44288791 CAGGGACCCTAGGGGGAAGCCGG - Intergenic
1107933040 13:45322095-45322117 TAGTGGGGCTAGAGCAAAGCAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113517463 13:110914661-110914683 CAGTGGGAGTCGGGGAAAGCGGG - Intronic
1113854845 13:113437477-113437499 CAGTGGGGCTTGGGAGAGGCAGG - Intronic
1113881046 13:113626514-113626536 GAGGGGGGCTGCGGGGAAGCGGG - Intronic
1113916133 13:113875135-113875157 CAGTGGGGCTGGGCCCAAGCAGG + Intergenic
1113933550 13:113981397-113981419 CAGAGAGGCTGGGAGGAAGCAGG + Intronic
1115262562 14:31469024-31469046 AAGTGGGGCTTGGGGGAATCTGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1116658066 14:47675356-47675378 GAGTGGGGCTAGGGGAACGGGGG + Intergenic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119385831 14:74257717-74257739 CGGCGGGGCTCGGGGGAAGTGGG - Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120751807 14:88204581-88204603 CAGCGGGGGTAGGGGGGAGTTGG - Intronic
1121102802 14:91261638-91261660 CTGTGGGGCCAGGGTGGAGCCGG + Intergenic
1121406233 14:93720855-93720877 CAGTGGGGATAGGAGGGAGAAGG + Exonic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1124813586 15:32966166-32966188 CCGTGGGGCTAGAGCCAAGCAGG - Intronic
1125521342 15:40349360-40349382 CTGTGGGTCTATGGGGAACCAGG - Intergenic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127634753 15:60858573-60858595 CAGCGGGGATGGGGTGAAGCAGG + Intronic
1127663616 15:61123281-61123303 CAATGAGGCGAGGGGGGAGCAGG + Intronic
1128138604 15:65282814-65282836 AAGTGGGGCAAGGGAGAAGGGGG + Intronic
1128727496 15:69998896-69998918 CAGTGGGGCTGGGGAGTGGCAGG - Intergenic
1128758250 15:70197589-70197611 CAGTGGGGGTAGGTGGGAGTCGG + Intergenic
1129789206 15:78329548-78329570 CAGTGGGGCAAGCGGGGAGCTGG - Intergenic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130108806 15:80948677-80948699 CAGTGTGGCTAGGCGGTACCTGG + Intronic
1131229766 15:90651433-90651455 CAAAGGGGCTTGGGGGCAGCTGG - Intergenic
1131487054 15:92829533-92829555 AAGTGGGGCCAAGGGAAAGCTGG + Intergenic
1131598869 15:93827123-93827145 CACTGGGGCTAGGAGGGAGTGGG - Intergenic
1132567733 16:630988-631010 CAGAGGGGCCAGGCTGAAGCTGG + Exonic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133304144 16:4799520-4799542 CTGTGGGGTCAGGGGCAAGCTGG - Intronic
1133497553 16:6333987-6334009 TGGTGGGGGTAGGGGGGAGCAGG + Intronic
1135278747 16:21136018-21136040 CAGTGATGGTAGGGGGATGCAGG + Intronic
1135403446 16:22181787-22181809 CAGGGGAGCTTGGGGGAAGCAGG + Intronic
1135520464 16:23172938-23172960 CAGTGGGGCTGGGGAGGGGCTGG - Intergenic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135848115 16:25937614-25937636 CTGGAGGGCTAGGTGGAAGCTGG + Intronic
1136135718 16:28255821-28255843 CCATGGGGCTGGGGGGAGGCGGG + Intergenic
1136382169 16:29900757-29900779 CAGGGGAGCTAGGAGGAAGCGGG + Exonic
1137374937 16:47944326-47944348 CAGCGGGGCAAGGGGAAAGCAGG + Intergenic
1138366378 16:56481303-56481325 CACTGGGGCGAGGGTGACGCTGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139516335 16:67454458-67454480 CAGAAGGGCCCGGGGGAAGCAGG + Intronic
1140056052 16:71526680-71526702 TAGTGGGGCTTGGGGGCTGCTGG - Intronic
1140256583 16:73342170-73342192 TGGTGAGGCTAGGGGGAAACAGG + Intergenic
1140805121 16:78526182-78526204 TAGTGGAGCTAGGGAGTAGCGGG + Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141448227 16:84078069-84078091 CAGTGAGGCTTTGGGGAAACCGG + Intronic
1141699710 16:85636764-85636786 CAGTGGTGCTAGGGGTGAGGGGG - Intronic
1141758505 16:86011121-86011143 CAGTGGAGCTCGGGGGAGGCAGG - Intergenic
1142029281 16:87830528-87830550 CAGGAGGGGGAGGGGGAAGCAGG + Exonic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143096784 17:4482638-4482660 CAGCGGGGCCAAGGGGAGGCTGG - Intronic
1143371626 17:6444201-6444223 CAGTGGCGCGAGCGGGACGCAGG + Intergenic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1143517415 17:7426843-7426865 AAGAGGGGTTAGGGGGCAGCCGG - Exonic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144438108 17:15259286-15259308 CGGTGTGGCTAGGTGGATGCGGG - Intronic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1145999848 17:29124590-29124612 CAGTGGGGCTAGGTGGTCACTGG + Intronic
1146536463 17:33657038-33657060 CAGAGTGGCTAGGGAGAAGGAGG + Intronic
1147006362 17:37407009-37407031 TAGCGGGACTAGGGAGAAGCGGG + Intronic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147629343 17:41919591-41919613 AAGTGGGGCTAGGAGGGTGCAGG + Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147768322 17:42851451-42851473 CAGAGGGGCAATGGGGAAGCTGG - Exonic
1147770913 17:42867383-42867405 CGGAGGGGCAATGGGGAAGCTGG - Intergenic
1147918290 17:43901275-43901297 CTGTGAGGCGAGGGGTAAGCAGG - Intronic
1147920491 17:43913719-43913741 CTGTGGGGCGTGGGGGAGGCTGG - Intergenic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1151174461 17:72275668-72275690 CAGTGCAGCTAGGATGAAGCAGG - Intergenic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1151633368 17:75326445-75326467 CAGTGGGACTAAGGGAAAGTGGG + Intronic
1151665932 17:75545153-75545175 GAGTGAGGCTAGGGTGGAGCTGG + Intronic
1152687896 17:81703607-81703629 CAGGCGGGTTAGGGGGCAGCCGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152773779 17:82187528-82187550 TGGTGGGGCTCGGGGGGAGCTGG + Intronic
1153443933 18:5151475-5151497 CAGTTGGGCTAGCAGCAAGCTGG - Intronic
1153602620 18:6796360-6796382 CAGGGGTGCTCGGGGGAGGCAGG - Intronic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1157517318 18:48320262-48320284 GAGTGGAGCGAGGGGGAAGTGGG + Intronic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160251824 18:77210022-77210044 CAGGGAGGCTGTGGGGAAGCCGG + Intergenic
1160712794 19:560404-560426 GAGGAGGGCTAGGGGGAAGAAGG + Intergenic
1160936775 19:1599786-1599808 GAGTGGAGCTGGGGGGAGGCTGG + Intronic
1161480043 19:4505875-4505897 CAGGGGGGCTGAGGGGAGGCCGG - Intronic
1161550288 19:4909043-4909065 CAGTGGGGCTTGGGGCGATCGGG + Intronic
1161737201 19:5998683-5998705 CACCGGGGCTGTGGGGAAGCTGG - Intronic
1161738442 19:6005841-6005863 CAGTGGGGCTTAAGGGAGGCTGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1163044119 19:14626662-14626684 CAGTAGGGCAATGAGGAAGCAGG + Intronic
1163173504 19:15549096-15549118 CAGTGGGGCCAAGGGGAGCCAGG - Intronic
1163758664 19:19121276-19121298 GGGTGGGGCTAGGAGGTAGCTGG - Intronic
1164400255 19:27897255-27897277 CAGAGGAGCAAAGGGGAAGCTGG - Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164615156 19:29663314-29663336 CAGTGGGGCCATTGGGATGCTGG - Intergenic
1165331021 19:35141283-35141305 GAGGGGGGCTAGGGAGAGGCGGG - Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1166449038 19:42881723-42881745 CAGTTGGGCTTGGGAGCAGCAGG + Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167722818 19:51190564-51190586 CAGTGGGGCCAGGTTGAGGCGGG - Intergenic
1167761494 19:51452668-51452690 CAGTGGGGCCAGGATGAGGCAGG + Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925164810 2:1709448-1709470 CAGCGGGGCTGGGGTGCAGCGGG + Intronic
925164815 2:1709464-1709486 CAGCGGGGCTGGGGTGCAGCAGG + Intronic
925900217 2:8503912-8503934 CAGTGCGGCTAGGATAAAGCAGG + Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
926089918 2:10043272-10043294 CAGCGGCGCCAGGGGCAAGCGGG - Intronic
926316222 2:11712140-11712162 CAGTGGGCATAAGGGGATGCCGG - Intronic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927199530 2:20569836-20569858 CGGTGGGGCAAATGGGAAGCAGG - Intronic
927245260 2:20952388-20952410 CAAATGGGCCAGGGGGAAGCAGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927928201 2:27027347-27027369 CATTGGGGCTAGGCTGGAGCTGG - Intergenic
928559790 2:32468640-32468662 AAGTGGCGCTAGGTGCAAGCCGG + Exonic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
931054168 2:58450011-58450033 CAGAGGGGCTTGAGGGAACCTGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
932843599 2:75110917-75110939 CAGTGAGGTTATGGGGAAGGTGG - Intronic
933067787 2:77819633-77819655 CAGTGCTGCTAGGAGAAAGCAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
936092867 2:109512202-109512224 CAGTGGGGCCAGGGCCCAGCAGG - Intergenic
937795176 2:126009010-126009032 TGGAGGGGGTAGGGGGAAGCTGG + Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
939918089 2:148073264-148073286 CATTTGGGGTAGGGGGTAGCAGG + Intronic
941580560 2:167292631-167292653 CGCTGGGGCGAGGGGGGAGCGGG - Intergenic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
945240999 2:207676891-207676913 CAGGGGGGCCAGGGGGAATCAGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947876279 2:233470159-233470181 CAGTGGGGGGAGGGAGGAGCGGG - Exonic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
948062504 2:235052091-235052113 CAGTGGGGCTTAGGAGAGGCAGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948586594 2:239023855-239023877 GCGTGGGGCTTGGGGGAAGAGGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948762198 2:240199178-240199200 CGGTGGGGGAGGGGGGAAGCAGG - Intergenic
1171128744 20:22628362-22628384 CAGTGGGACAAGGAGCAAGCAGG - Intergenic
1172170590 20:32929347-32929369 CACCGGGGCCAGTGGGAAGCAGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172870205 20:38131050-38131072 CTTTGGGGCCTGGGGGAAGCGGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173733248 20:45342653-45342675 AGGTGGGGGTTGGGGGAAGCAGG + Intronic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174706633 20:52662974-52662996 CAGTAGGACTAGGGTGAACCTGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175322848 20:58101559-58101581 CAGTGTGGCTCGGGGCCAGCAGG - Intergenic
1175332850 20:58176874-58176896 CAGAGGGGCTTTGGAGAAGCAGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175504614 20:59472748-59472770 AAGTGGGGTAAGGGGGATGCAGG + Intergenic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176289861 21:5038075-5038097 CAGTGGGGAGAGGGGAGAGCGGG - Intronic
1177998865 21:28135403-28135425 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1179411695 21:41167900-41167922 CAGCGGGGCTCGGGGGGCGCCGG - Exonic
1179502849 21:41820904-41820926 CAGCAGGGCTCGGGGGCAGCTGG - Intronic
1179867390 21:44225564-44225586 CAGTGGGGAGAGGGGAGAGCGGG + Intronic
1182003412 22:26939621-26939643 CAGAGGGTTTAGGGGGCAGCAGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182301550 22:29340005-29340027 CAGTGCTGCTAGGGTGAGGCAGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182791985 22:32960652-32960674 CTGAGGGGCATGGGGGAAGCTGG - Intronic
1182926706 22:34131904-34131926 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183475862 22:38035427-38035449 CAGTGGGGCAAGTGGGAATCAGG + Intronic
1183709165 22:39492327-39492349 CAGTGGGGAGAGGGGGCTGCAGG + Intergenic
1184333427 22:43840081-43840103 GAGTGGGGCCAAGGGGAAGGGGG + Intronic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1185065955 22:48631822-48631844 CAGGGGGCCTAGGGGGCAGCTGG + Intronic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
950145513 3:10647075-10647097 CAATGGGGGTAGGGGGAATGGGG + Intronic
950196268 3:11011261-11011283 CATAGGGGCAAGGGGGAAGCAGG - Intronic
950883658 3:16344490-16344512 TAGTTGGGCGAGGGGGAAGAAGG - Intronic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
955744993 3:62131608-62131630 CAATGGGGGATGGGGGAAGCAGG + Intronic
955857696 3:63291054-63291076 CAGTGGGAAAAGGGGGTAGCTGG + Intronic
955991329 3:64630603-64630625 CAATGGGGCTTGTGGGATGCAGG + Intronic
956860142 3:73314664-73314686 CAGGTGATCTAGGGGGAAGCAGG + Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960463541 3:117967178-117967200 CAGTGAGGCTAGAACGAAGCTGG + Intergenic
961263180 3:125618920-125618942 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
961357661 3:126349290-126349312 CAGGGGACCTTGGGGGAAGCTGG + Intronic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
964592645 3:158382578-158382600 GACTGGGGGTAGGGGGTAGCTGG - Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965881583 3:173395139-173395161 CAGAGAGGCTAGTGGGAAGCGGG + Intergenic
966972955 3:185061915-185061937 CGGAAGGGCTAAGGGGAAGCAGG - Intergenic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968353206 3:198080253-198080275 CTGCGGGGCTGCGGGGAAGCCGG + Intergenic
968529707 4:1084959-1084981 CCGTGGGGCCTGTGGGAAGCTGG - Intronic
968708459 4:2095177-2095199 TATTGGGGCTAGGGGGTAGGGGG + Intronic
969643330 4:8412215-8412237 GAGTGGGGCTAGGAGAAAGTAGG - Intronic
970444584 4:16113028-16113050 CAGTGAGGCTGGGAGGAAACAGG + Intergenic
970446064 4:16124241-16124263 CAGTGAGGGTCGGGGGTAGCAGG + Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
973637248 4:52871508-52871530 GAGGGGGGCTTGGGGGAAGGAGG - Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
975099905 4:70501043-70501065 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
976569924 4:86595371-86595393 CGGTGGGGCTAGGGGGCCGGAGG - Intronic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
978734599 4:112071075-112071097 CAGATGGGCTTTGGGGAAGCTGG + Intergenic
979889058 4:126066382-126066404 CAGTGGGGCTAGAACAAAGCCGG - Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
983411108 4:167399243-167399265 CAATGGGCCTAATGGGAAGCAGG - Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985513755 5:326720-326742 CAGTGGGGCTATGGAGAAATTGG - Intronic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
992583436 5:78206506-78206528 CAGTAGGGCAAGGAGGAAGAAGG + Intronic
994691629 5:103026827-103026849 CAGTGGGGCCTAGGGGAAGGTGG + Intronic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998451173 5:142235689-142235711 CGGTGGGGCCAGGAGGAAGTGGG - Intergenic
998552012 5:143086908-143086930 CAGTGGAGGTAGGGGGTAGGCGG - Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001551629 5:172606634-172606656 CAGTGGGGCTAAGGCGGAGGGGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002410968 5:179076214-179076236 CAGTGGGAGTAGGGGAAAACAGG - Intronic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1003554704 6:7129313-7129335 TAGTGGGGCAAGGTGGAAGGTGG + Intronic
1004251227 6:14024640-14024662 GAGTGGGGCTTGGGGAAAGTAGG + Intergenic
1004693442 6:18012188-18012210 CAGTGGGGAGTGGGGGGAGCTGG - Intergenic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1005711452 6:28506876-28506898 GAGTGGGGCCGGGGGGATGCAGG - Intronic
1006378368 6:33684179-33684201 CACTGGGGCATGGGGGCAGCAGG + Intronic
1006491452 6:34392074-34392096 CGTTGGGGCTGAGGGGAAGCGGG - Intronic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1007257455 6:40538783-40538805 GACTGGGGCTGGGGGGAAGGAGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1009524104 6:64721284-64721306 AAGTGGGGCTAGGGGCAGGAAGG + Intronic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1011027118 6:82881265-82881287 CATTGGGGCTAGGAGGATGTAGG + Intergenic
1011640409 6:89412104-89412126 CAGCGGGGCCCGGCGGAAGCGGG + Exonic
1012959764 6:105609950-105609972 CAGTGGGGCTTCCTGGAAGCTGG - Intergenic
1013793455 6:113859579-113859601 CAGGGGCCTTAGGGGGAAGCGGG + Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1015639530 6:135316175-135316197 CAGTGGATCTTGGAGGAAGCAGG - Intronic
1016243307 6:141956384-141956406 CACTGGGGGTAGGGTGAAGGAGG - Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1020280400 7:6647331-6647353 CATTGGTGCTTGGGGGAGGCGGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022728310 7:33000233-33000255 CACCTGGGCTATGGGGAAGCTGG + Exonic
1024936856 7:54719601-54719623 CAGAGTGGGTAGGGGGAAGTGGG - Intergenic
1025045340 7:55687784-55687806 CACCTGGGCTATGGGGAAGCTGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1028587628 7:92467695-92467717 CTGTGGGGTTTTGGGGAAGCTGG + Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032503388 7:132417120-132417142 CTTTGAGGCCAGGGGGAAGCGGG - Intronic
1032548442 7:132762597-132762619 CAGGGGCGCCAGGAGGAAGCAGG + Intergenic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1035253596 7:157612834-157612856 CAGAGGCGCTGGGGTGAAGCGGG + Intronic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038863376 8:31412193-31412215 CAGGGGGTCTAGGGGGAGGTGGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039721498 8:40169305-40169327 CAGTGGGGTCAGGGGAAAGTGGG + Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040604048 8:48912213-48912235 CAGTGGGGCTGGGAAGCAGCTGG - Intergenic
1042810956 8:72824558-72824580 GAGTGTGCCTAGGGTGAAGCAGG - Intronic
1045653261 8:104362493-104362515 CTGAGGGGCTATGGAGAAGCTGG - Intronic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049577473 8:143396401-143396423 CAGTGGGGCTGAGAGGAGGCTGG + Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1052282089 9:26744896-26744918 GAGTGAGGCTCGGGGGAATCAGG - Intergenic
1053409473 9:37906271-37906293 CAGTGGTGAAAGGGGGAAACAGG - Intronic
1055357751 9:75454791-75454813 CAGGGGGACTATGGGGAAGTTGG - Intergenic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1055701920 9:78954144-78954166 CAGTGTGGTTAGGAGGGAGCAGG - Intergenic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058528000 9:105879232-105879254 CCCTGGGGGTAAGGGGAAGCTGG - Intergenic
1059427672 9:114231256-114231278 GAGGGGTGCTAGGAGGAAGCTGG + Intronic
1060251300 9:121988488-121988510 CAGAGGGGTGAGTGGGAAGCAGG - Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061924979 9:133801562-133801584 CAGTGGGGCTAGGGGTGTGCAGG - Intronic
1062179915 9:135185776-135185798 CAGTGGCCTTAGGGGGAAGCCGG - Intergenic
1062343494 9:136104073-136104095 CAGTGGAGGGATGGGGAAGCGGG + Intergenic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062644657 9:137541349-137541371 GAAAGGGGCTTGGGGGAAGCTGG - Intronic
1185451991 X:286856-286878 AGGTGGGGGTAGGGGGCAGCAGG + Intronic
1186874545 X:13804131-13804153 CAGTGGGGCTGGGTGGGACCTGG + Intronic
1187077196 X:15947035-15947057 CGGTGGGGGTAGGGGGGAGGCGG + Intergenic
1187214310 X:17261344-17261366 TACAGGGGCTAGGGAGAAGCTGG + Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187704564 X:21996918-21996940 CAGCGGGGCTAGAGGAAGGCTGG + Intergenic
1189685233 X:43556826-43556848 CAGTGGAGCTAGGGGTCACCAGG - Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190970278 X:55341851-55341873 CAGTGGGGCTTTGGGGCAGAGGG - Intergenic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1195533337 X:105982467-105982489 CAGTGGGGAGAGGGAGAGGCTGG + Intergenic
1196971909 X:121118860-121118882 CAGTGGCGCTATTGAGAAGCTGG - Intergenic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1197871839 X:131068677-131068699 CAGTGGGGCTCGGGGGGTGGGGG - Intronic
1198279405 X:135126854-135126876 GAGTGGGGCTGGGGTCAAGCAGG + Intergenic
1198291551 X:135245660-135245682 GAGTGGGGCTGGGGTCAAGCAGG - Intergenic
1198338846 X:135693876-135693898 CAGTGGGGCCAAGGAGGAGCAGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198978404 X:142363741-142363763 CATCGGGGCAAGGGGGAGGCAGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic