ID: 1104607969

View in Genome Browser
Species Human (GRCh38)
Location 12:130203787-130203809
Sequence TAAGATACACACGTAGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104607966_1104607969 -9 Left 1104607966 12:130203773-130203795 CCACTTGAGAGCTTTAAGATACA No data
Right 1104607969 12:130203787-130203809 TAAGATACACACGTAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104607969 Original CRISPR TAAGATACACACGTAGTGCG GGG Intergenic
No off target data available for this crispr