ID: 1104614010

View in Genome Browser
Species Human (GRCh38)
Location 12:130253666-130253688
Sequence GTGTGTGCTTGGGTGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104614001_1104614010 7 Left 1104614001 12:130253636-130253658 CCAAATGACCTCCAGGCAAGGTG No data
Right 1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG No data
1104614005_1104614010 -4 Left 1104614005 12:130253647-130253669 CCAGGCAAGGTGTGAGGTGGTGT No data
Right 1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG No data
1104614003_1104614010 -1 Left 1104614003 12:130253644-130253666 CCTCCAGGCAAGGTGTGAGGTGG No data
Right 1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104614010 Original CRISPR GTGTGTGCTTGGGTGGAAGA GGG Intergenic
No off target data available for this crispr