ID: 1104616626

View in Genome Browser
Species Human (GRCh38)
Location 12:130275783-130275805
Sequence CATAACCTGCCCAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104616626_1104616630 -5 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616630 12:130275801-130275823 TTATGCCTTTCTATAAAATGGGG No data
1104616626_1104616632 4 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616632 12:130275810-130275832 TCTATAAAATGGGGTGATAATGG No data
1104616626_1104616634 23 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616634 12:130275829-130275851 ATGGTACCTTGCTCATGGTGTGG No data
1104616626_1104616628 -7 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616628 12:130275799-130275821 GGTTATGCCTTTCTATAAAATGG No data
1104616626_1104616629 -6 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616629 12:130275800-130275822 GTTATGCCTTTCTATAAAATGGG No data
1104616626_1104616633 18 Left 1104616626 12:130275783-130275805 CCATCCTTCTTGGGCAGGTTATG No data
Right 1104616633 12:130275824-130275846 TGATAATGGTACCTTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104616626 Original CRISPR CATAACCTGCCCAAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr