ID: 1104616635

View in Genome Browser
Species Human (GRCh38)
Location 12:130275835-130275857
Sequence TTTAATCCACACCATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104616635_1104616639 -1 Left 1104616635 12:130275835-130275857 CCTTGCTCATGGTGTGGATTAAA No data
Right 1104616639 12:130275857-130275879 ATAGGGGATATGCACACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104616635 Original CRISPR TTTAATCCACACCATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr