ID: 1104619725

View in Genome Browser
Species Human (GRCh38)
Location 12:130302003-130302025
Sequence CATTTTTCCCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104619725_1104619739 29 Left 1104619725 12:130302003-130302025 CCCTCTTCCCTCTGGGAAAAATG No data
Right 1104619739 12:130302055-130302077 CAGATGTTACCTCCTCAGTGAGG 0: 2
1: 5
2: 30
3: 223
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104619725 Original CRISPR CATTTTTCCCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr