ID: 1104628359

View in Genome Browser
Species Human (GRCh38)
Location 12:130378148-130378170
Sequence CTGCTTGCAAAGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104628359_1104628362 -9 Left 1104628359 12:130378148-130378170 CCATCTTGCCTCTTTGCAAGCAG No data
Right 1104628362 12:130378162-130378184 TGCAAGCAGTCCTCCCCACCGGG No data
1104628359_1104628361 -10 Left 1104628359 12:130378148-130378170 CCATCTTGCCTCTTTGCAAGCAG No data
Right 1104628361 12:130378161-130378183 TTGCAAGCAGTCCTCCCCACCGG No data
1104628359_1104628369 19 Left 1104628359 12:130378148-130378170 CCATCTTGCCTCTTTGCAAGCAG No data
Right 1104628369 12:130378190-130378212 ATGCAGCAGTGACCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104628359 Original CRISPR CTGCTTGCAAAGAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr