ID: 1104630546

View in Genome Browser
Species Human (GRCh38)
Location 12:130397758-130397780
Sequence TCTCTGTCTCGAGGGAGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104630539_1104630546 5 Left 1104630539 12:130397730-130397752 CCCCAGACATAAATGTGTGGGTT 0: 1
1: 1
2: 0
3: 24
4: 173
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1104630536_1104630546 16 Left 1104630536 12:130397719-130397741 CCAGAGAGAGGCCCCAGACATAA 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1104630534_1104630546 27 Left 1104630534 12:130397708-130397730 CCCACAGCACGCCAGAGAGAGGC 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1104630535_1104630546 26 Left 1104630535 12:130397709-130397731 CCACAGCACGCCAGAGAGAGGCC 0: 1
1: 0
2: 1
3: 18
4: 241
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1104630540_1104630546 4 Left 1104630540 12:130397731-130397753 CCCAGACATAAATGTGTGGGTTC 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1104630541_1104630546 3 Left 1104630541 12:130397732-130397754 CCAGACATAAATGTGTGGGTTCC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104630546 Original CRISPR TCTCTGTCTCGAGGGAGTGC GGG Exonic
900956408 1:5888781-5888803 CCTCTGTCTTCAGGAAGTGCAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903589004 1:24440255-24440277 TCTCTGTCCCCAGACAGTGCTGG - Intronic
905920767 1:41717131-41717153 TCTGGGTCTCGTGGGAGTTCAGG + Intronic
907871290 1:58445836-58445858 TTTCTGTCTCTGGGGAGTGGAGG - Intronic
910043524 1:82883994-82884016 TCTCTGTCTTGGGAGAGGGCAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912864817 1:113247622-113247644 TCTGTGACTCTAGGCAGTGCAGG + Intergenic
915559252 1:156676907-156676929 TCTCTGCCTCGACGGCGCGCCGG + Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
920378733 1:205523426-205523448 TCTCTGTCCTGAGGGAGAGAAGG - Intronic
923142509 1:231172616-231172638 TCTCCTTCTGGAGTGAGTGCTGG - Intronic
1063138437 10:3236748-3236770 GCTCTGCCTCGAGCGTGTGCTGG + Intergenic
1063361468 10:5462973-5462995 TCTCAGGCTGGAGGGAGGGCAGG - Intergenic
1065999676 10:31092531-31092553 TTTCTCTCTTGAGGTAGTGCAGG + Intergenic
1066008003 10:31165779-31165801 GCTCTGGCTCCAGGCAGTGCCGG + Intergenic
1069748527 10:70731438-70731460 GCTCTGTCTGGGGGGACTGCAGG + Intronic
1070750086 10:78958899-78958921 TCTCTGTGTAGAGGCTGTGCTGG - Intergenic
1075391761 10:122097426-122097448 TCTATGTCCCGAGAGAGGGCAGG + Intronic
1075949483 10:126464444-126464466 TCTCAGCCTCAAGGGAGTACTGG + Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1078541974 11:12220197-12220219 TCTCTGTGTCGATGTAGTCCTGG - Exonic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080685690 11:34513229-34513251 TCTCTGTATCGAGGGGGTGGGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1089392259 11:118110184-118110206 TCTCTGTCCTGGGGCAGTGCTGG - Intronic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097489084 12:60241847-60241869 TCTCTTTCTTCAGGAAGTGCTGG - Intergenic
1098725863 12:73966081-73966103 TCTCTGTCTCTAGCGTGTCCAGG + Intergenic
1101444296 12:104726584-104726606 TCTCTGTCTTGGGGGAGAGGAGG - Intronic
1103729810 12:123019977-123019999 TCTGTGTCTAGAGGGAGCCCTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1106792885 13:33173880-33173902 TCTCTGTCTTGACTGAGTACAGG - Intronic
1107797242 13:44065254-44065276 TCTGTGGCTCCAGGGAGAGCCGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111826241 13:93271340-93271362 TCACTGTCTTGGGGGAGGGCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122631705 14:103110227-103110249 TCTCTGGCTCGAGGGGGGGCCGG + Exonic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1129641276 15:77381053-77381075 TCTCTGTGAAGAGGGAGAGCAGG - Intronic
1129928109 15:79384192-79384214 TCACTGCCTCGAGAGAGTTCTGG - Intronic
1132806082 16:1775784-1775806 TCTCTGTCCCCAGGCAGTACCGG + Exonic
1132985467 16:2764760-2764782 TCTTTCTCTCGAGGGTGTTCTGG - Exonic
1135743105 16:24993649-24993671 TCCCTGTTTCGTGGGTGTGCAGG + Intronic
1136237782 16:28925187-28925209 GCTCCGTCACCAGGGAGTGCGGG - Exonic
1142611807 17:1112587-1112609 ACTCTGTCTTGAGGGAGGGAGGG + Intronic
1142881264 17:2884018-2884040 CCTCTCTCTCCAGGGAGAGCAGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146456563 17:33013927-33013949 GGTCTGTTTGGAGGGAGTGCTGG + Exonic
1151513029 17:74573307-74573329 TCTCTGGGTCAAGGGAGAGCGGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152498405 17:80691700-80691722 TGTCTGTCTCCAGGGAGTCTTGG + Intronic
1152538141 17:80962089-80962111 GCTCTGTCTCCCGGGACTGCAGG + Intronic
1153584224 18:6604712-6604734 TTTTTGCCTCGAGGGAGTGTTGG - Intergenic
1156479774 18:37428819-37428841 TCTCAGCCACTAGGGAGTGCGGG - Intronic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1158404372 18:57147769-57147791 TCTGGCTCTGGAGGGAGTGCTGG - Exonic
1161893826 19:7064833-7064855 TCACTGTCTTGAGGAAGTGTTGG - Intergenic
1162369076 19:10268303-10268325 TTTCTGTCTCCAGGAAGGGCAGG - Intergenic
1162492079 19:10998869-10998891 ACTCTTTCTCCAGGGAGTCCTGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165700850 19:37936310-37936332 TGGCTGTCTGGATGGAGTGCTGG - Intronic
1167238549 19:48329648-48329670 TCTCTGCCCCCAGGGATTGCTGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
928094407 2:28394777-28394799 GCTCTGTCTCGAGAGAGAGCTGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933031083 2:77329574-77329596 TCTCTGTGCAAAGGGAGTGCAGG - Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937274464 2:120674994-120675016 GCCCTCTCTCGAGGGGGTGCTGG - Intergenic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
938053321 2:128194704-128194726 TCTCTGCCTTGAGGTAGTGAGGG + Exonic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1173003929 20:39125238-39125260 TCTCTGTTTCTGGGGAATGCTGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175126723 20:56757781-56757803 TCTCTCTCTAAAGGGAGTGGTGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179643512 21:42761858-42761880 TGTCTGTCTGGTGGGACTGCAGG + Intronic
1179931092 21:44571472-44571494 GCTCTGTCTCCTGGGAGGGCTGG + Intronic
1180189852 21:46157654-46157676 TCTGTGTCTGGAGGGAGACCAGG + Intergenic
1181858185 22:25797855-25797877 GCTCCGTCTCGAAGGAATGCGGG - Intronic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1182442688 22:30373457-30373479 TGTCTGTGTCTAGGGAATGCTGG - Intronic
1183347238 22:37314672-37314694 GCTCTGTCTCCAGGGAGGCCTGG + Exonic
949566119 3:5246332-5246354 TCTCTCTCGTGAGGGAGTCCAGG + Intergenic
952233133 3:31452937-31452959 TCTCTGGTTCAAGGAAGTGCAGG + Intergenic
953752027 3:45616307-45616329 TCACTCTCTCGAGGGACAGCTGG + Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
956364298 3:68483169-68483191 TCTCTGTCTCCAGTGTGTGCTGG - Intronic
959650527 3:108746265-108746287 TCTCTGCTTCGTAGGAGTGCTGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
961196633 3:125007330-125007352 ACTCTGCCTGGAGTGAGTGCAGG - Intronic
961420218 3:126797123-126797145 TCTCTCTCTGCAGGGTGTGCAGG + Intronic
962263289 3:133928319-133928341 TCTCAGTCTCAAGGCAGAGCGGG - Exonic
963853076 3:150226853-150226875 TCTCTGTGTAGGGAGAGTGCAGG + Intergenic
966270979 3:178105166-178105188 TCTCTGTCTCCTGGCAGAGCTGG - Intergenic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
967248918 3:187517167-187517189 TCTCTTCCTCCAGGCAGTGCTGG - Intergenic
967287737 3:187889739-187889761 TCTCTATCTCTGGGGACTGCTGG + Intergenic
969268951 4:6085807-6085829 CCTCTGTCTTGTGGGAGTGACGG - Intronic
969680980 4:8643310-8643332 ATTCTGTCTCCAGGGAATGCTGG - Intergenic
971395891 4:26227051-26227073 TCTCTGTCTCAAGGAAGTGGAGG + Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975666725 4:76740849-76740871 TCTCTGGCTCGCTGGAGAGCTGG - Exonic
983923306 4:173370622-173370644 TCTCTGTTTCTAGGGAATTCGGG - Intronic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
987066277 5:14292968-14292990 TCTCTTTCTGGAGTGATTGCGGG + Intronic
989757064 5:44968090-44968112 CCTCTGTATCAAGGGTGTGCAGG + Intergenic
993887346 5:93430996-93431018 TCTCTGACTCCAGGGGATGCTGG - Intergenic
994555497 5:101295744-101295766 TCTCTGTTTCTATGGAGTGATGG - Intergenic
996042422 5:118830558-118830580 GCTATTTCTCCAGGGAGTGCTGG + Intergenic
998646260 5:144065734-144065756 CCTCTGTCTCTAGAGAGTGAGGG - Intergenic
1002493005 5:179592845-179592867 TATCTGTCTCGTTTGAGTGCTGG - Intronic
1003177431 6:3762426-3762448 TCTCTGGCTAGGGGCAGTGCAGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005988304 6:30887927-30887949 CTTCTCTCTCGAGGGAATGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007473057 6:42103286-42103308 GCTCTGTCTGGTGGGTGTGCAGG - Exonic
1013054163 6:106567242-106567264 TCTCTGTCTCGGCAGAGTGTAGG + Intronic
1014734669 6:125078527-125078549 TCTGTGTCTCGTGGGCTTGCTGG - Intronic
1016668062 6:146667406-146667428 TCTCTGGCACAAGGGAGTGAGGG + Intronic
1017995071 6:159525199-159525221 TTTCTGCCTTGAGAGAGTGCAGG - Intergenic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1019702061 7:2478824-2478846 ACCCTGACTCCAGGGAGTGCAGG + Intergenic
1024250394 7:47501755-47501777 TCACTGTCTCGTGGGAGGACTGG + Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024628916 7:51231530-51231552 TCTCTGGATCGGGGAAGTGCAGG + Intronic
1029095570 7:98082579-98082601 TCTCTGTCTGGTGGGAGAACGGG - Intergenic
1035491196 7:159280211-159280233 GCACTGTCTCTAGGGACTGCAGG + Intergenic
1037986119 8:23291696-23291718 TCTCTTTCCCGAGGGACGGCCGG - Intronic
1039552712 8:38454594-38454616 TGTCTGGCTAGAGGAAGTGCAGG - Intronic
1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047961144 8:130012733-130012755 TCTCTTTCTAGAGGCAGTGAAGG - Intronic
1049106907 8:140619684-140619706 TCTGTGTCTCGCAGGGGTGCGGG + Intronic
1054743159 9:68828718-68828740 TGTCTGTCTCCAGGGAGAACCGG + Intronic
1055509888 9:76985818-76985840 TCTCTGTCTCGGGGGAAGCCTGG - Intergenic
1059043784 9:110842501-110842523 GCTCTGTCTTGAAGGAGTGGAGG + Intergenic
1059539484 9:115116618-115116640 TTTCTGTCCGGAGGGAGGGCAGG - Intronic
1059795277 9:117687798-117687820 TGTCTTTCTCGAGTGAATGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190298159 X:49040620-49040642 TCTCTGTCTCAGGGGAGGGCTGG - Intronic
1190792677 X:53714734-53714756 TCTCTCTGTCAAGGCAGTGCTGG - Intergenic
1191937190 X:66438383-66438405 TCTTTGGCTGGAGGGAGTCCCGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194956860 X:100190928-100190950 TCTCTGTTACCAGGAAGTGCAGG - Intergenic
1195750135 X:108156291-108156313 TCTCTGGCTGGAGGGGGAGCCGG + Exonic
1198420327 X:136465276-136465298 TCTCTGTCTGTTGGCAGTGCTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic