ID: 1104632019

View in Genome Browser
Species Human (GRCh38)
Location 12:130411323-130411345
Sequence GTCACACCTGGTGTACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104632019_1104632028 23 Left 1104632019 12:130411323-130411345 CCAGTCTGTACACCAGGTGTGAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1104632028 12:130411369-130411391 TTATGACCTCCAGTATGATGTGG 0: 1
1: 0
2: 0
3: 18
4: 145
1104632019_1104632021 0 Left 1104632019 12:130411323-130411345 CCAGTCTGTACACCAGGTGTGAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1104632021 12:130411346-130411368 TTCCCCTCACCATGTCGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 274
1104632019_1104632030 29 Left 1104632019 12:130411323-130411345 CCAGTCTGTACACCAGGTGTGAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1104632030 12:130411375-130411397 CCTCCAGTATGATGTGGAAAAGG 0: 1
1: 0
2: 18
3: 77
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104632019 Original CRISPR GTCACACCTGGTGTACAGAC TGG (reversed) Intronic
900090701 1:919204-919226 GTCACATCTGGGGTCCAGCCTGG + Intergenic
900972591 1:5999825-5999847 GGCGCACATGGGGTACAGACAGG - Intronic
913666499 1:121053296-121053318 GGGACACCTGGTGCACAGAAGGG + Intergenic
914018184 1:143840408-143840430 GGGACACCTGGTGCACAGAAGGG + Intergenic
914656800 1:149748942-149748964 GGGACACCTGGTGCACAGAAGGG + Intergenic
916047916 1:161014506-161014528 GTCTCATCTGTTGTACAGGCTGG - Intronic
919636131 1:200005437-200005459 ATTATACTTGGTGTACAGACAGG + Intergenic
921746188 1:218743139-218743161 GTCACACCTGAAGTGAAGACTGG - Intergenic
1063823486 10:9865539-9865561 GTCACACCATTTGTATAGACAGG - Intergenic
1074889034 10:117720129-117720151 GTCACCCCATGTGGACAGACTGG + Intergenic
1077199475 11:1298320-1298342 GCCACACGTGGGGGACAGACAGG + Intronic
1081689360 11:45066687-45066709 CTAACACCTGGAGTACAGTCTGG - Intergenic
1085848725 11:80096034-80096056 GTGAGACCTGGAGGACAGACAGG + Intergenic
1089130355 11:116207606-116207628 GTCACAACTGGTGGAAAGGCAGG - Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091691897 12:2602973-2602995 GTCACACCTGTGGTAGAGAAAGG + Intronic
1098909509 12:76194730-76194752 GTAATAACTGGTGTACAGAGTGG - Intergenic
1104632019 12:130411323-130411345 GTCACACCTGGTGTACAGACTGG - Intronic
1110692291 13:78444672-78444694 GTCACACCGGGTGTGCATATGGG + Intergenic
1112750821 13:102581601-102581623 ATCACACCTGGGATTCAGACAGG - Intergenic
1113022569 13:105904577-105904599 CTCACAGCTAGTGAACAGACTGG - Intergenic
1113697265 13:112355147-112355169 CTCACACCTGGTGTTCCAACCGG - Intergenic
1116229762 14:42201714-42201736 GTCACAGCTGGTGCAGAGAAAGG + Intergenic
1116358806 14:43966610-43966632 GTCACACCTTATGTCCAGAATGG + Intergenic
1119137388 14:72233071-72233093 GTTACACCTGGTATACATTCAGG - Intronic
1122004782 14:98693171-98693193 GTCACAACTGGTGGACATAAGGG + Intergenic
1123121940 14:105920771-105920793 ATCACACCTGGTGGACAGTTTGG - Intronic
1127220136 15:56870966-56870988 GTCTCACTTGGTGCCCAGACTGG - Intronic
1129791924 15:78346941-78346963 CTCACATCAGGTTTACAGACTGG + Intronic
1129980164 15:79861923-79861945 GTCACATCTGGGGAACAGGCTGG + Intronic
1131997090 15:98143513-98143535 CTCACACCAGGGGTAAAGACTGG - Intergenic
1132419084 15:101649642-101649664 GTGACAGCTAGTGTACAGAGGGG - Intronic
1134415145 16:14037076-14037098 GCCACATCTGGTCTACAGATGGG - Intergenic
1135100256 16:19599024-19599046 GCCACACCTCGTGTAGAGAGAGG - Intronic
1141936460 16:87242261-87242283 TTCAGACCTGGTGTGCAGAAGGG - Intronic
1144732477 17:17536724-17536746 GTCGCACCTGGTGGACGGGCAGG - Intronic
1151801329 17:76381668-76381690 ACCACACCCGGTGTAGAGACGGG + Intronic
1151820756 17:76495586-76495608 GTCTCACCTATTGTACAGAGAGG + Intronic
1152522148 17:80862798-80862820 GGTGCACATGGTGTACAGACGGG + Intronic
1157154452 18:45251923-45251945 GTCTCTCCTGGTGTAGAGTCTGG + Intronic
1162330000 19:10021931-10021953 GTCACAGCTGGAGCACAGAGAGG + Exonic
1164694190 19:30231440-30231462 CTCACACCTGCTGTGCACACTGG + Intronic
926444114 2:12923108-12923130 GGCCCACCTGGTGCACAGATGGG + Intergenic
928671381 2:33606908-33606930 GTCTCACCTTGTGTCCAGGCTGG + Intergenic
930378234 2:50594835-50594857 GTCACCCCTGGTGTTGAGATAGG - Intronic
938954832 2:136287975-136287997 GCCACACTTGGTGCACAGCCAGG + Intergenic
946037992 2:216759345-216759367 GTCCCACCTGTTGCCCAGACTGG + Intergenic
1174414950 20:50360325-50360347 GGGACACCTGGTGCACAGCCTGG + Intergenic
1175655460 20:60765979-60766001 CTCACACCTGGTGAACACCCAGG + Intergenic
1176092756 20:63326218-63326240 GTGGCAGCTGGTGTTCAGACTGG - Intronic
1176199554 20:63854288-63854310 GGCACACCTGGAGTGCAGAGGGG + Intergenic
1184122172 22:42458986-42459008 GTCTCAGCCTGTGTACAGACTGG - Intergenic
1184424215 22:44399685-44399707 GGCACACCTGGGGCACAGAGAGG + Intergenic
951550783 3:23873141-23873163 CTCACACCTGGTGTAGATTCAGG + Intronic
956747236 3:72319743-72319765 GTCACACCACGTGTACATAATGG + Intergenic
958636932 3:96756797-96756819 GTCACTGCTGCTGTCCAGACAGG + Intergenic
961877167 3:130031893-130031915 GTCACACAGGGTGTACACACAGG + Intergenic
965767989 3:172152015-172152037 ATCAAACCTGGTGATCAGACAGG - Intronic
985995442 5:3594972-3594994 TGCACACCTGGTGGACAAACCGG + Intergenic
987048211 5:14127066-14127088 GTCACACCTGGTGTAGGATCTGG - Intergenic
990335266 5:54766132-54766154 GTCAGACCTGCTATACAGAAGGG - Intergenic
994392237 5:99202192-99202214 GTCACAGTGGGTGTACACACAGG + Intergenic
995030411 5:107474243-107474265 ATCAGACCTGGTGTACAAACTGG - Intronic
996582651 5:125048655-125048677 GTCACACATGGGGTAGAAACTGG + Intergenic
997434999 5:133867592-133867614 GACACACATGGTGAACACACAGG + Intergenic
1004210589 6:13638323-13638345 ATCACACTTGTTGTACAGAGTGG + Intronic
1004562486 6:16762587-16762609 GTCACACCTGGCGGCGAGACAGG - Intergenic
1006726224 6:36201030-36201052 AGCACTCCTGGTGTACAGCCAGG - Exonic
1010195512 6:73235856-73235878 GTCACACTTGTTGTCCAGGCTGG + Intronic
1012004699 6:93698177-93698199 GTCACACAGGGTGTACACATAGG + Intergenic
1012652740 6:101777313-101777335 GTCACACATGGAGAACAGGCTGG - Intronic
1017931415 6:158958933-158958955 GTGCCACCTGCTGTACACACTGG + Intergenic
1017944221 6:159080524-159080546 GTCCCACTTTGTGCACAGACTGG + Intergenic
1018792064 6:167156404-167156426 TTCCCACCTGCTGTGCAGACTGG - Exonic
1024560768 7:50643366-50643388 GTCCCATCTGGTCCACAGACAGG - Intronic
1027498611 7:78920260-78920282 TTTACAGCTGGTGTACAGAGGGG - Intronic
1029342823 7:99958604-99958626 ATCACAGATGGTGTACACACAGG - Intergenic
1032804385 7:135340236-135340258 GTCACCCCTGCTGTACTCACAGG - Intergenic
1034819138 7:154200809-154200831 TTCACAGCTGGTGTCCAGGCGGG - Intronic
1037079307 8:14763965-14763987 GGTACACCTGGTGTTCAGATGGG + Intronic
1038236762 8:25766148-25766170 GTCTCACCTGTTGCCCAGACTGG - Intergenic
1038570183 8:28655518-28655540 CTCACACCTGTTGCACAGGCTGG + Intronic
1039478035 8:37851526-37851548 GTCACACATGATGTACTTACTGG + Intergenic
1042277064 8:67016719-67016741 GTCACACCTGTAATACAGCCTGG - Intronic
1042565010 8:70102170-70102192 GTGTCACCTGGTTTACAGGCTGG + Intergenic
1046442043 8:114269507-114269529 GTCACACCTGATAAAGAGACTGG - Intergenic
1049214454 8:141401429-141401451 GTCACACCCTGTTTACAGAGGGG - Intronic
1049288712 8:141790578-141790600 GACAGACCTGGTGGACAGGCGGG + Intergenic
1049411242 8:142474900-142474922 CTCACACCTGGTGTCCAACCAGG - Intronic
1059939641 9:119345896-119345918 ATCACACCTACTTTACAGACAGG + Intronic
1190875791 X:54459235-54459257 GTCTCATGTGGAGTACAGACTGG + Intronic
1199726414 X:150587042-150587064 GTCACACCCATTTTACAGACTGG + Intronic