ID: 1104634682

View in Genome Browser
Species Human (GRCh38)
Location 12:130430297-130430319
Sequence CAGGCAGATGGCCCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104634673_1104634682 5 Left 1104634673 12:130430269-130430291 CCCTCCAGTCCTCAGTGGAGAAT 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 301
1104634676_1104634682 -4 Left 1104634676 12:130430278-130430300 CCTCAGTGGAGAATGCCAGCAGG 0: 1
1: 1
2: 3
3: 39
4: 209
Right 1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 301
1104634674_1104634682 4 Left 1104634674 12:130430270-130430292 CCTCCAGTCCTCAGTGGAGAATG 0: 1
1: 2
2: 0
3: 14
4: 206
Right 1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 301
1104634671_1104634682 27 Left 1104634671 12:130430247-130430269 CCTAGGGGGACACGCAGCTTTAC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 301
1104634675_1104634682 1 Left 1104634675 12:130430273-130430295 CCAGTCCTCAGTGGAGAATGCCA 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104634682 Original CRISPR CAGGCAGATGGCCCTCCCTG GGG Intronic
900090360 1:917635-917657 CAAGCAGAGGCCCCTCCCTCAGG - Intergenic
900403439 1:2482330-2482352 TGGGCTGATGGCCCTCCCAGGGG - Intronic
900639567 1:3682231-3682253 CAGGCAAGTGGGCCTGCCTGGGG - Intronic
901344213 1:8524756-8524778 CAGACAGATGGCTTTCACTGTGG - Intronic
902373499 1:16019268-16019290 CAGTCAGAGAGGCCTCCCTGGGG - Intronic
902435661 1:16396801-16396823 CTGGCAGCTGGCCCTTCCTCCGG - Exonic
902821437 1:18945702-18945724 CTGGCAGAAGCCCCTCCATGTGG - Intronic
903180272 1:21601781-21601803 CAGCCGGAGGGCTCTCCCTGCGG + Exonic
904128781 1:28260378-28260400 CGGGCAGAGGACCCTTCCTGGGG + Intronic
904381211 1:30112277-30112299 CAGACAGATGTTCCTGCCTGGGG + Intergenic
905348077 1:37325075-37325097 CAGGCAGCTAGCCTCCCCTGGGG - Intergenic
905704087 1:40040998-40041020 CGGGCAGAGGGGCCTCCCCGGGG - Intronic
907044187 1:51289694-51289716 CTGTCACATTGCCCTCCCTGAGG + Intronic
910362132 1:86423615-86423637 CTGGCAGTTGGCCCTCTCTGGGG + Intergenic
910773347 1:90851446-90851468 CGGGCAGAGGGCCCTGCTTGGGG - Intergenic
911162755 1:94698036-94698058 GAGCCAGATGGCCCTCTGTGAGG - Intergenic
911939033 1:104018914-104018936 CAGGCCTATGTCCCTCCCTTTGG + Intergenic
912271982 1:108220830-108220852 GAAGCAGATTGCCCTCCCTAAGG + Intergenic
912724338 1:112045406-112045428 CAGGAAGATGGAACTCCTTGAGG + Intergenic
915537130 1:156543561-156543583 CAGGAAGATGGCACTCCCTTGGG + Intronic
915620588 1:157080986-157081008 AAGGCAGTTGACCCTGCCTGTGG + Intergenic
915950482 1:160186907-160186929 CAGGACCATGCCCCTCCCTGCGG - Exonic
916849055 1:168684182-168684204 CAGGCAGCTGCCCCTCCCCCTGG + Intergenic
917488747 1:175479321-175479343 CATTCAGAGGGCCCTCCCAGGGG + Intronic
918097100 1:181344781-181344803 CAGGCCGATGGCCAGCCCGGGGG - Intergenic
919809297 1:201398990-201399012 CTGGGATATGGCCCCCCCTGTGG - Intronic
920379835 1:205529028-205529050 CGGGAAGAGGGGCCTCCCTGTGG - Exonic
922188880 1:223299683-223299705 CAAGCAGATTACCCTCCCTAAGG + Intronic
922273097 1:224052616-224052638 CAGGCAGAGAGACCTCGCTGAGG - Intergenic
922798402 1:228352889-228352911 CAGGGAGAGGGCCCTACCCGTGG + Intronic
923370006 1:233300495-233300517 CAGGCAGAATGCCCACCCTAGGG - Intergenic
924565601 1:245195667-245195689 CAGGCAGATGGGCCTTCCCAGGG - Intronic
1062910468 10:1208776-1208798 CAGGAACCAGGCCCTCCCTGTGG - Intronic
1063220434 10:3962028-3962050 AAGGTATATGCCCCTCCCTGGGG - Intergenic
1063555470 10:7075022-7075044 CAGGCAGAAGGACATCTCTGTGG + Intergenic
1065116409 10:22487529-22487551 CAGGCAGATGTTCCTTCCAGTGG - Intergenic
1065828970 10:29597270-29597292 CATGCAGAAAGCCCGCCCTGAGG + Intronic
1065867320 10:29925456-29925478 AAAGCAGATGGCCCTCCCCAGGG + Intergenic
1066697359 10:38091061-38091083 AGGGCAGATGGGGCTCCCTGGGG + Intergenic
1069703080 10:70440530-70440552 GGGCCAGACGGCCCTCCCTGGGG - Intronic
1070590914 10:77800450-77800472 CAGGCAGAGGGCCGCCGCTGAGG + Intronic
1070895460 10:79980209-79980231 CAAGCAGGAGTCCCTCCCTGTGG - Intronic
1071306134 10:84300140-84300162 GAGGCAGCTGGCCCTGACTGGGG + Intergenic
1072632626 10:97156884-97156906 CATGCAGAAGGCCCTGCCGGTGG + Intronic
1072663649 10:97379084-97379106 AGGCCAGGTGGCCCTCCCTGTGG - Intronic
1073184429 10:101607292-101607314 CAGGCTGAGGGCTCTTCCTGGGG - Intronic
1073466638 10:103698108-103698130 CGGGCAGCAGGCCCTCGCTGGGG + Intronic
1073490833 10:103852304-103852326 CAGGCAGCTCCCCCTCCCCGTGG + Intronic
1073951866 10:108818844-108818866 AAGGCAGATGGCCCTGACTCAGG - Intergenic
1074794258 10:116925224-116925246 AAAGCAGATGGTCCTCCCTGAGG + Intronic
1074853848 10:117458969-117458991 AAGGCAGAGAGCCCTACCTGGGG - Intergenic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1075202120 10:120412987-120413009 AAGGCAGATGGCCCTCCCCATGG + Intergenic
1075257769 10:120939171-120939193 GAGGCAGGAGGGCCTCCCTGAGG - Intergenic
1075491590 10:122875981-122876003 CATGCAGACAGCCCACCCTGAGG + Intronic
1075850492 10:125582186-125582208 CAGGCTGCCAGCCCTCCCTGAGG - Intronic
1076081016 10:127580629-127580651 CAGGCCCCTGGCTCTCCCTGTGG + Intergenic
1076195916 10:128518118-128518140 CACGCACACGGCCCTCCGTGAGG + Intergenic
1076495192 10:130892627-130892649 CTGGCCCCTGGCCCTCCCTGTGG - Intergenic
1076642730 10:131929718-131929740 CCGGCAGCTGACTCTCCCTGGGG + Intronic
1076713128 10:132350004-132350026 CAGGGTGGTGGCCCTTCCTGAGG + Intronic
1076737440 10:132465125-132465147 AAGGCTGACGGCCTTCCCTGAGG + Intergenic
1077998845 11:7476618-7476640 CAGGCAGCTGTCCCATCCTGGGG + Intergenic
1078210491 11:9265753-9265775 CAGGGAGAAGGCCCTGTCTGGGG - Intergenic
1078847318 11:15130004-15130026 CAGGCAGATGTGGCTGCCTGTGG + Intronic
1079028314 11:16966426-16966448 CAGGCAGAAAGTCCACCCTGTGG + Intronic
1079444237 11:20545372-20545394 CAGGCAGCTGGGCCTCTGTGTGG + Intergenic
1079452272 11:20607206-20607228 AAGGCAGGTCTCCCTCCCTGGGG - Intronic
1080344808 11:31312525-31312547 AAAGCAGATGGCCCTCCCCAGGG + Intronic
1080489418 11:32747309-32747331 TAGGCAGGTGCCCCTCCCTCTGG - Intronic
1082054360 11:47800903-47800925 CAGGCAGAGGGCACTATCTGAGG + Intronic
1083683276 11:64361022-64361044 CAGGCAGATGACTTTCTCTGGGG + Intronic
1084478493 11:69402386-69402408 AAGGCAGAGGGCCTTGCCTGAGG + Intergenic
1084572557 11:69968326-69968348 GAGGCAGAGGGTCATCCCTGGGG - Intergenic
1084606770 11:70176967-70176989 CAGGCGGATGGCTCTCCGTGTGG - Intronic
1085223509 11:74896416-74896438 CAGGCAGAGGAGCCTCTCTGTGG - Intronic
1085512544 11:77095660-77095682 CAGACAGATGGCCTCTCCTGGGG - Intronic
1086349491 11:85931234-85931256 GAGCCAGATGGCCCTCTCGGAGG - Intergenic
1086597391 11:88589667-88589689 CAGGCAGAGAGCCCTCCATGTGG - Intronic
1089583404 11:119495463-119495485 CAGCCAGAGGGACCTGCCTGAGG + Intergenic
1091127928 11:133118584-133118606 AAGGCAGATGGCCATACATGCGG - Intronic
1092111380 12:5967411-5967433 CAGGCAGTGGGACCTCACTGCGG - Intronic
1092661145 12:10739665-10739687 CAGGAAGAGAGCCCTCCCTGGGG + Intergenic
1092661170 12:10739799-10739821 CAGGAAGAGAGCCCTCACTGCGG + Intergenic
1092705610 12:11281159-11281181 CAGGCAGATGTGCCTCCTTGTGG + Intergenic
1092713663 12:11365430-11365452 CAGGCAGATGTGCCTACTTGTGG + Intronic
1092714473 12:11374634-11374656 CAGGCAGATGTGACTCCTTGTGG + Intronic
1092718185 12:11413668-11413690 CAGGCAGATGTGACTCCTTGTGG + Intronic
1096117956 12:49066770-49066792 CATCCAGGTGACCCTCCCTGGGG + Intronic
1096514129 12:52147050-52147072 CAGGCCCATGGCTCTCACTGAGG + Intergenic
1098329008 12:69332949-69332971 GAGCCAGATGGCCTTCTCTGGGG - Intergenic
1098915255 12:76250698-76250720 CAGGCACTTCGCCCTTCCTGAGG + Intergenic
1099687740 12:85910865-85910887 CAGGAAATTGGCCCTCCCTGGGG - Intergenic
1102865365 12:116369922-116369944 CAGGCAGATGGAACAGCCTGTGG + Intergenic
1102952630 12:117040686-117040708 CGTGCAGATGGCCCACCCCGGGG - Intronic
1103629043 12:122244506-122244528 CAGGTAGATGCCCACCCCTGAGG - Intronic
1104031077 12:125065968-125065990 CAGGCAGCTGGCCCTCCCGAGGG - Intronic
1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG + Intronic
1104888956 12:132130580-132130602 CAGGCAAATGGCCCTCGATGTGG + Intronic
1105073595 12:133253883-133253905 TAGCTAGATGCCCCTCCCTGGGG - Intergenic
1105874766 13:24541680-24541702 CAGGCACATGGAGCTCCCTCGGG + Intergenic
1106760025 13:32859035-32859057 CAGGAAGGGGGCCCTCTCTGTGG + Intergenic
1108027108 13:46189559-46189581 TAAGCAAATGGCCCTCCCTAAGG - Intronic
1108510236 13:51148909-51148931 CAGGCAGCTGCTCCTTCCTGGGG + Intergenic
1109330716 13:60926078-60926100 AAAGCAGATGGCCCTCCATAAGG - Intergenic
1110027001 13:70552914-70552936 CAGGAAGATGTTTCTCCCTGGGG + Intergenic
1110725373 13:78816838-78816860 CCTGCAGCTGGGCCTCCCTGTGG - Intergenic
1111916370 13:94364853-94364875 AAGGAAGATGCCCCTCCCTATGG + Intronic
1112550865 13:100419121-100419143 CAGGAAGAAGGACCTCTCTGAGG - Intronic
1113917446 13:113882998-113883020 CAGGGAGATGGCCAGGCCTGCGG - Intergenic
1118639973 14:67783107-67783129 CAGCCAGAGGCACCTCCCTGCGG + Exonic
1119649696 14:76374939-76374961 CAGGCGGCTGGCCCCTCCTGGGG + Intronic
1119658885 14:76436677-76436699 CAGGCTGATGGTCTTTCCTGGGG + Intronic
1119781587 14:77279745-77279767 CAGGCAGCCGGCCCTCCCCAGGG + Intronic
1120871293 14:89339546-89339568 GAGGCAGAAGGACCTCTCTGGGG + Intronic
1120969843 14:90198165-90198187 CAGGCAGAGCGCCCTCCTTCGGG + Intergenic
1121990116 14:98549054-98549076 CAGCCTGATGGCCCGCTCTGCGG - Intergenic
1122326036 14:100881152-100881174 CAGGGAGGTGGCCCTCCTGGGGG + Exonic
1122800575 14:104227482-104227504 CAGGCTGACGGCCCTACATGGGG - Intergenic
1122967166 14:105136758-105136780 CAGGCAGATGCCCCGCCGAGGGG - Intergenic
1126385996 15:48094030-48094052 AAAGCAGATTGCCCTCCATGAGG + Intergenic
1128072815 15:64807937-64807959 CAGGCAGATGCCCGCCCCAGGGG - Intergenic
1128452785 15:67815868-67815890 CAAGCAGACGGCCCCCACTGGGG - Intergenic
1131040710 15:89263897-89263919 CAGTCAGAGGGACATCCCTGTGG - Exonic
1131117511 15:89804072-89804094 CTGGCAGATGGCCAGCCCTGGGG - Intronic
1131328197 15:91469216-91469238 CAGGCAGATGTCTCTCCATGTGG + Intergenic
1131709205 15:95034536-95034558 CATGCAGATGGGCCTCTCTTTGG + Intergenic
1132336416 15:101051143-101051165 CAGGCAGTTGGCCGGCCCTGAGG + Intronic
1132664954 16:1077293-1077315 CAGGGACAAGCCCCTCCCTGGGG - Intergenic
1132819603 16:1857217-1857239 CGGGAGGATGGCCCTCCGTGGGG - Intronic
1133139599 16:3734482-3734504 CAGGCAGGTGCCCCCTCCTGGGG + Intronic
1136636578 16:31528133-31528155 CAGGCAGATGGCTCTTCTTAAGG + Exonic
1138144343 16:54595445-54595467 CAGGGAGACAGCCCTCCCAGGGG - Intergenic
1139787348 16:69404562-69404584 CAGGCAGAGTGCACGCCCTGGGG + Intronic
1139855179 16:69974351-69974373 CAGGCACAAGCCCCTGCCTGCGG - Intergenic
1139884897 16:70201484-70201506 CAGGCACAAGCCCCTGCCTGCGG - Intergenic
1140367620 16:74394041-74394063 CAGGCACAAGCCCCTGCCTGCGG + Intergenic
1140527233 16:75633004-75633026 CAGCCAGATGGCCCTCTTGGGGG + Intronic
1141392766 16:83678378-83678400 CAGGCAGGAGGACCTCTCTGTGG + Exonic
1141621618 16:85239386-85239408 CTGGCAGAGATCCCTCCCTGGGG + Intergenic
1141660031 16:85436723-85436745 CAGGCAGCTGGCCCGCCCCTCGG - Intergenic
1142984837 17:3689457-3689479 CACGCAGGGAGCCCTCCCTGAGG - Intronic
1143532319 17:7512606-7512628 CAGGAAGAGGGCCCTCCAGGTGG + Intronic
1143609907 17:8012221-8012243 CAGCCAGGTTGCCCTCCCAGAGG - Exonic
1144576653 17:16433880-16433902 CAGGCAGATGGCCAGTCATGTGG - Intronic
1144723585 17:17489162-17489184 CTTGCAGAGGGGCCTCCCTGTGG + Intronic
1144758490 17:17694349-17694371 CAGGAAGACGGGCCTTCCTGTGG + Intronic
1144942368 17:18950611-18950633 CAGGCAGTTGAGCCTGCCTGAGG + Intronic
1145278951 17:21454714-21454736 CAAGTAGATGGCCTTCTCTGTGG - Intergenic
1145398917 17:22515784-22515806 CAAGTAGATGGCCTTCTCTGTGG + Intergenic
1148149084 17:45385450-45385472 CAGGCAGAGGGAGGTCCCTGTGG - Intergenic
1148150641 17:45394904-45394926 CAGGCAGGAGGTCATCCCTGAGG + Exonic
1148207329 17:45787277-45787299 CAGGCCCCTGCCCCTCCCTGGGG - Intronic
1149852420 17:60046457-60046479 AAGGAAGATGGACCTCTCTGAGG - Intronic
1152597683 17:81245930-81245952 CAGGCACATGGTCCCCCCCGCGG + Exonic
1152754965 17:82083409-82083431 CAGGAAGATAGCCATGCCTGCGG + Exonic
1156353528 18:36321971-36321993 CAGCCAGGTGGCCCTGCCTCTGG - Intronic
1156355721 18:36338732-36338754 CAGCCAGCTGGACTTCCCTGAGG + Intronic
1157075170 18:44457937-44457959 CTTGCAGATGTACCTCCCTGGGG - Intergenic
1158205158 18:54984936-54984958 CAGGGAGTTGTCCTTCCCTGAGG - Intergenic
1158571505 18:58600463-58600485 GAGGCTGATGGCCCTCCCCAGGG + Intronic
1159128637 18:64254749-64254771 CAGGGAGATGGTCCACACTGAGG + Intergenic
1160246199 18:77162159-77162181 CAGCCAGAAGCCCCACCCTGTGG - Intergenic
1160313405 18:77818943-77818965 CCAGAAGCTGGCCCTCCCTGGGG - Intergenic
1161060707 19:2213464-2213486 CAGGGCGTGGGCCCTCCCTGTGG + Intronic
1161238307 19:3208607-3208629 CGGCCAGTTGGTCCTCCCTGGGG + Exonic
1161705848 19:5821088-5821110 TGGGCAGGGGGCCCTCCCTGAGG - Intergenic
1161849904 19:6732881-6732903 CTGGCGGATGGCCCTCCCACAGG + Intronic
1162064241 19:8115471-8115493 CAGGCAGAGGGGACTCCCCGGGG - Intronic
1163314225 19:16531484-16531506 CAGGGAGATGGCTGCCCCTGGGG + Intronic
1163474566 19:17517452-17517474 CCGGCAGGTGGCTCTCCCTCTGG - Intronic
1163483476 19:17572694-17572716 CAGGCAGATGCAAGTCCCTGTGG + Intronic
1164965326 19:32478227-32478249 CAGGCAGAGGTCCCGACCTGGGG - Intronic
1165488771 19:36111244-36111266 CAGGCAGATGGCCCCAGTTGGGG - Exonic
1166310748 19:41961094-41961116 GAGGAAGATGGCCCTGTCTGAGG + Intergenic
1166334801 19:42099367-42099389 CAGGGAGATGGGCTTGCCTGAGG + Intronic
1167106079 19:47430511-47430533 CAGGCGGATGCCCGCCCCTGTGG - Intronic
1167583252 19:50358816-50358838 CAGGCAAATGGCCGTCCTTGTGG - Intronic
925147989 2:1593852-1593874 CAGGTTGCTGCCCCTCCCTGGGG + Intergenic
925745752 2:7042265-7042287 CAGGCAGATGGCCCTGGGTTTGG + Exonic
927241185 2:20920666-20920688 CTGACAAATGGCCCTCCCTCTGG + Intergenic
927343285 2:22007196-22007218 AAAGTAGATTGCCCTCCCTGAGG - Intergenic
927495648 2:23549973-23549995 CAGGGAGCTGGGCCACCCTGGGG + Intronic
927956534 2:27211425-27211447 CAGGGCGCTGGCCCACCCTGGGG + Intronic
928294886 2:30074021-30074043 GAGACAGACAGCCCTCCCTGCGG + Intergenic
929524978 2:42693488-42693510 CAGGCAGAGGGGCCTCCCTGTGG + Intronic
930439626 2:51390180-51390202 CAGGCAGAGGAACCTCCCTGTGG + Intergenic
931137126 2:59415402-59415424 CAAGCAGATAGCCCTCCTTCAGG - Intergenic
933354357 2:81195355-81195377 CCAGCCGAAGGCCCTCCCTGCGG - Intergenic
934862905 2:97779381-97779403 GAGGCAGAGGCCACTCCCTGTGG - Intronic
937431217 2:121840393-121840415 CAAGTAGACTGCCCTCCCTGAGG - Intergenic
938263061 2:129908938-129908960 CCCGCAGCTGGCCCTCCCCGAGG - Intergenic
938587783 2:132708145-132708167 CAAGCAGATGTCCCTCCCCATGG - Intronic
944125910 2:196292525-196292547 CAGGCATTTGGCACTCCCTGAGG + Intronic
946177035 2:217928366-217928388 CAGGCAGCTGGCCTTCACCGGGG + Intronic
947136161 2:226978756-226978778 CAGGCAAAGGACCCTCACTGGGG + Intronic
949059293 2:241947527-241947549 CGGGCAGATGGCCCTGCACGGGG - Intergenic
1169277424 20:4243288-4243310 CAGGCAGCAGGCTCTCACTGCGG + Intronic
1172182744 20:33013658-33013680 GAGTGAGATGGCCCTACCTGGGG - Intronic
1172392599 20:34575863-34575885 CAGGAAGAAAGCTCTCCCTGAGG + Intronic
1173523781 20:43717117-43717139 CAGGCACATGAACATCCCTGTGG + Intergenic
1173883461 20:46436754-46436776 CAGGCAGTGGGGCCTCTCTGGGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174778864 20:53370265-53370287 CAGGCAGGTGGACTTCCCGGAGG + Intronic
1175174499 20:57102780-57102802 CGGGCAGAATGCCATCCCTGGGG - Intergenic
1175191631 20:57215668-57215690 CAGGCAGCTGCCCATCCGTGTGG - Intronic
1175339457 20:58218887-58218909 CAGGCAGCAGGACCTCCCTGAGG - Intronic
1175517418 20:59578070-59578092 GAGGCCCATGGCCCTCCCTGGGG - Intronic
1175846381 20:62061179-62061201 CATGCAGACGGCCACCCCTGAGG - Intronic
1176081873 20:63277615-63277637 CAGGCAGATGGGCAACTCTGGGG - Intronic
1176267836 20:64220020-64220042 CAGCCAGCTTGCCCTGCCTGAGG + Intronic
1176282174 20:64319755-64319777 AAGGCACAGGGACCTCCCTGGGG + Intergenic
1179315232 21:40238100-40238122 AGGAAAGATGGCCCTCCCTGGGG + Intronic
1179921570 21:44510340-44510362 CAGGCAGAAGGCCCTCCGGACGG - Intronic
1179952664 21:44718868-44718890 CAGGGAGAGGGCCCAGCCTGGGG - Intergenic
1180698646 22:17769961-17769983 CAGGAAGGTGGCCATCCCCGAGG - Intronic
1180791823 22:18578725-18578747 CATGCAGATAGCCTTCCCAGGGG + Intergenic
1181229913 22:21416584-21416606 CATGCAGATAGCCTTCCCAGGGG - Intergenic
1181248736 22:21518282-21518304 CATGCAGATAGCCTTCCCAGGGG + Intergenic
1181367212 22:22387267-22387289 GAGCCAGATGGCCCTCTCGGTGG - Intergenic
1181827149 22:25526541-25526563 CAGGAAGAGAGCCCTCACTGGGG - Intergenic
1183603364 22:38853052-38853074 CAGGCAGATGAGCCCCCCAGAGG + Intergenic
1184769776 22:46590255-46590277 CAGGCCGAGGGCCATCCATGTGG - Intronic
1185041463 22:48506592-48506614 CTGGCAGGGGGCCCTGCCTGAGG - Intronic
1185363476 22:50423310-50423332 CTGGCAGACGGCCCTCCCTGAGG + Intronic
949466807 3:4352765-4352787 CAGACAGATGGCCCTGCCATGGG - Intronic
949491836 3:4596805-4596827 AAGCCAGATGTCACTCCCTGGGG + Intronic
950406909 3:12810429-12810451 AAGGCAGACGGCCCACCCTTAGG - Intronic
951138373 3:19130965-19130987 CAGGAAGATGCTTCTCCCTGGGG - Intergenic
951267769 3:20589468-20589490 GAGCCAGATGGCCCTCTCGGGGG - Intergenic
953407783 3:42668026-42668048 GGAGCAGATGGCTCTCCCTGGGG + Intergenic
954583420 3:51715803-51715825 CAGGCAGATGGCCACCTGTGAGG - Exonic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
956248674 3:67212915-67212937 CTGTAAGATGGCCATCCCTGTGG + Intergenic
958151252 3:89697248-89697270 CATGCAGATGGCCCACCCTAAGG + Intergenic
960845505 3:122001107-122001129 CAGGCAAATGTCCTTCCATGTGG + Intronic
960968779 3:123124379-123124401 CCGGCAGATGCCCCGCCCTCTGG - Intronic
960994577 3:123332461-123332483 CAGGCACATGCCCATCCCTGGGG + Intronic
961017555 3:123479492-123479514 TGGGCAGCTGGCCCTCCGTGGGG - Intergenic
961117986 3:124348269-124348291 CAGGCAGACAGCCCTCAATGTGG + Intronic
966404099 3:179577641-179577663 CAGACAGTTGGACCTCCCTGAGG - Intronic
967111003 3:186293822-186293844 CCGGCAGAGGCCCCTCTCTGTGG + Intronic
967744990 3:193045370-193045392 CAGGCACAGGGGCCTACCTGAGG + Intergenic
967877691 3:194277941-194277963 CAGGCAGCCGGCCCCCCATGAGG + Intergenic
969264899 4:6057872-6057894 AAGCCAGGTGGGCCTCCCTGAGG + Intronic
969697050 4:8740850-8740872 CAGGGAGGTGGCCCACCATGAGG - Intergenic
972083996 4:35190509-35190531 GAGCCAGATGGCCCTCTCTGGGG + Intergenic
973842896 4:54880521-54880543 CAGGAAGAGAGCCCTCACTGGGG - Intergenic
973919781 4:55673409-55673431 CAGGGAAATTGGCCTCCCTGTGG + Intergenic
974123979 4:57673173-57673195 CAGGCAGAGGGCATTTCCTGAGG + Intergenic
975409529 4:74033107-74033129 CAGGCACATGGCCTCCCATGTGG - Intergenic
975493045 4:75009605-75009627 CAGGTAGGCAGCCCTCCCTGAGG + Intronic
975582731 4:75921398-75921420 CAGGCAGATCGCCCTCACAAAGG + Intronic
977249869 4:94677608-94677630 CTGGCAGATGGCTCTCCTTTAGG + Intergenic
982397199 4:154925516-154925538 CTGGCAGTTGGCCCTCCCCTTGG + Intergenic
982600541 4:157443629-157443651 CTGGCAGGTGGCCCTGCCTGGGG + Intergenic
983871394 4:172828374-172828396 CAGGCAGGTTTCCCTCCCTGTGG - Intronic
984579940 4:181500364-181500386 CAGGCAGATAGCCCTGACCGGGG + Intergenic
984874728 4:184357003-184357025 CTGGGAGATGGTCCTTCCTGTGG + Intergenic
986170514 5:5310883-5310905 CAGGCAGCTGACCCTCTCTGGGG - Intronic
986195748 5:5535332-5535354 CAGGCAGAAGGCTGCCCCTGAGG - Intergenic
986297362 5:6449937-6449959 CAGGCAGCTGTCCCTCCCCACGG - Intronic
988132355 5:27121180-27121202 GAGCCAGATGGCCCCCTCTGGGG + Intergenic
988399630 5:30746094-30746116 GAGGCAGATGGCCTTTGCTGGGG - Intergenic
988411975 5:30897760-30897782 CAGGGAGTTGAGCCTCCCTGAGG - Intergenic
992747055 5:79830299-79830321 CAGGCAGATTGCCCTCTCTGAGG + Intergenic
993724781 5:91355024-91355046 CAGGAAGAGGGCCCTCACTGGGG - Intergenic
995368384 5:111389577-111389599 CATGCAAATGGCACTCCTTGTGG - Intronic
995578610 5:113570327-113570349 CAGGCAGATGGATCACCTTGAGG - Intronic
998165718 5:139842411-139842433 CAGTCACATGGCCCTGGCTGAGG - Exonic
999191655 5:149752401-149752423 CAGGCAGCTGGGTCTTCCTGGGG - Intronic
1003892138 6:10572972-10572994 CAGGCAAATGGCCGGCTCTGTGG + Intronic
1004178086 6:13358039-13358061 CTGGGAGGCGGCCCTCCCTGCGG - Exonic
1004274413 6:14222711-14222733 CAGGGAGATGGGCTTACCTGGGG + Intergenic
1005555547 6:26978221-26978243 CAGGGAGATGGCCCTTTGTGTGG + Intergenic
1006916183 6:37595218-37595240 CAGGGCCATGTCCCTCCCTGGGG - Intergenic
1007621126 6:43215277-43215299 CAGGCAGATGTCCCTTTCTGTGG + Exonic
1013301579 6:108809377-108809399 CAGCCCACTGGCCCTCCCTGCGG + Intergenic
1015560589 6:134511070-134511092 CAGGAAGAGAGCCCTCACTGGGG - Intergenic
1016426673 6:143942473-143942495 GAGGCACCTGGCCCTCCATGCGG - Exonic
1016849211 6:148600127-148600149 GAGAAAGATGGCCCTCTCTGTGG - Intergenic
1017760870 6:157567081-157567103 GAGGCAGATGGATCACCCTGAGG - Intronic
1018040112 6:159914612-159914634 CAGGGATTTGGACCTCCCTGTGG + Exonic
1018346429 6:162903975-162903997 CAGGCTGCTGGCCTGCCCTGTGG - Intronic
1018818687 6:167356070-167356092 CAAGCAGAAGGCCCTCCCTTAGG - Intronic
1018871086 6:167782824-167782846 CAGGCAGCTGACCTGCCCTGTGG - Intergenic
1018900230 6:168048178-168048200 CAGGCAGATGCCCCTGGCTCAGG + Intergenic
1019058930 6:169242113-169242135 AGGGCAGATGGTCCTCCCTGTGG - Intronic
1019524435 7:1474418-1474440 CAGGCAGTGGGGCCTTCCTGGGG - Intronic
1019570351 7:1708551-1708573 CAGGGAGAGGGCCCTGCCAGGGG + Intronic
1019592523 7:1842838-1842860 CGCCCAGCTGGCCCTCCCTGTGG + Intronic
1021861518 7:24910680-24910702 CTACCAGATGGCCCACCCTGGGG - Intronic
1023043629 7:36193630-36193652 CCTTCAGATGGCCCTGCCTGTGG + Intronic
1023731387 7:43195440-43195462 CAGGCAGATCTGCCGCCCTGTGG - Intronic
1023841770 7:44102163-44102185 CAGGCTGATGTGCCTCCCTTTGG - Intergenic
1023875547 7:44284465-44284487 CTGGCAGATGGCACGCCCTGGGG + Intronic
1024277354 7:47688831-47688853 CAGGCAGAGGGGGCACCCTGGGG - Intergenic
1024555857 7:50603178-50603200 CAGGCTGATCATCCTCCCTGAGG - Intronic
1029203337 7:98853698-98853720 CATGAGGATGCCCCTCCCTGGGG - Intronic
1029379748 7:100205264-100205286 CAGGCACCTGGCCATCCCTGGGG + Exonic
1029495329 7:100893374-100893396 CACGCAGCTGGCCCACCTTGTGG - Exonic
1031574785 7:123401673-123401695 CAGGCTGATGGTGCTCTCTGGGG + Intergenic
1032539383 7:132690708-132690730 CAGGCAGATGGCCCTCAGTTTGG + Intronic
1034968326 7:155404745-155404767 CAGGAAGATGGGCCCCGCTGGGG - Intergenic
1038038354 8:23704846-23704868 CAGGGTGCTGGCCCACCCTGCGG - Intronic
1038283497 8:26186567-26186589 CAGGCAGATGTTCCTCCCAAGGG + Intergenic
1038312831 8:26457985-26458007 CAGGCAGCTGGGCCTCCCGTGGG + Intronic
1039476265 8:37840908-37840930 CTGGCAGATGGCCCTGCCAGTGG - Intronic
1041804879 8:61839192-61839214 CAGGCAGAATGGACTCCCTGTGG + Intergenic
1044835586 8:96292508-96292530 GAGGCAGAGGGCCCTGCCTGAGG + Intronic
1046025068 8:108712501-108712523 ATGGCAGATGGGCCTCCTTGTGG + Intronic
1046562944 8:115862784-115862806 CAGGAAGTTGGCCATCCCTCAGG - Intergenic
1048536717 8:135303225-135303247 CCATCAGATGGCTCTCCCTGGGG + Intergenic
1049461043 8:142727939-142727961 CAGGCAGCGGGCCTTCCCTAGGG - Intronic
1051539198 9:18195332-18195354 CACACAGATGGCCTTCCCGGAGG - Intergenic
1051722063 9:20047563-20047585 ATGGAAGATGGCCCTCCATGAGG + Intergenic
1052716921 9:32128652-32128674 CAGGCAGCTGCCCCTCCCCCAGG - Intergenic
1053459574 9:38257984-38258006 CTGGCAAATGGCTCTCCCTGGGG + Intergenic
1057064706 9:92038032-92038054 CAGGCAGCAGGCCCTCCCATTGG - Intronic
1057225168 9:93289259-93289281 CAGGCTGACGGCCCCCACTGCGG - Exonic
1057705591 9:97392817-97392839 CCTGCAGAAGGCACTCCCTGGGG - Intergenic
1057810940 9:98256074-98256096 CCGGAAGATGGGCCTCCCAGCGG - Intergenic
1057914825 9:99047633-99047655 CAGGTAGAAGCCCCTGCCTGCGG - Intronic
1060498439 9:124134784-124134806 CAGGCAGGTGGGCTGCCCTGGGG + Intergenic
1060663110 9:125415916-125415938 GAGGCAGATGGCCCAGACTGAGG + Intergenic
1060798321 9:126527431-126527453 CAGGGAGATGGCAGGCCCTGTGG - Intergenic
1061647141 9:132013063-132013085 CGGGCATCTGGCCCTCCCAGAGG + Intronic
1061762900 9:132862773-132862795 CGGGCAGATCCCCCTTCCTGAGG + Intronic
1062107075 9:134761550-134761572 CAGGCAGGCGGGGCTCCCTGAGG + Intronic
1062207549 9:135345749-135345771 CAGGGTGGTGGCCCTCCCTCTGG - Exonic
1062220722 9:135413694-135413716 GAAGCAGAAGGCCCTCCGTGGGG - Intergenic
1062333129 9:136053211-136053233 GAGCCAGATGGCCCTCTCTCTGG - Intronic
1186556814 X:10568677-10568699 CAGGCAGCTGGGCCACCCTCGGG - Intronic
1187546303 X:20255875-20255897 AAGGCAGATGGATCACCCTGAGG + Intronic
1188005346 X:25012850-25012872 CAGCCCGCTGTCCCTCCCTGGGG + Intronic
1188939146 X:36215859-36215881 GAGCCAGATGGCCCTCTCCGGGG + Intergenic
1189848347 X:45156584-45156606 CAGGCAGATGGCTCTGCATTTGG + Intronic
1193368625 X:80665460-80665482 CCGGAAGATGAGCCTCCCTGAGG - Intergenic
1196002739 X:110804164-110804186 CAGGATGATGTCCCTGCCTGTGG - Intergenic
1197437789 X:126453447-126453469 AAGGCTGATGGCCTGCCCTGTGG - Intergenic
1200731992 Y:6752615-6752637 CATGCAGAGAGTCCTCCCTGTGG - Intergenic