ID: 1104636594

View in Genome Browser
Species Human (GRCh38)
Location 12:130441528-130441550
Sequence GTCCAGGGGTGCATGTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104636589_1104636594 6 Left 1104636589 12:130441499-130441521 CCAGGCAGTATCCAACTCAGTGA 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG 0: 1
1: 0
2: 1
3: 19
4: 178
1104636590_1104636594 -5 Left 1104636590 12:130441510-130441532 CCAACTCAGTGAGTATGTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG 0: 1
1: 0
2: 1
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104636594 Original CRISPR GTCCAGGGGTGCATGTGACA CGG Intronic
905344296 1:37300995-37301017 GCCCAGGGGTGCATTCCACAGGG - Intergenic
905397524 1:37676364-37676386 GCCCTGGGGTTCATGTGGCAGGG + Intergenic
905480188 1:38256443-38256465 GTGCGTGTGTGCATGTGACATGG - Intergenic
907582758 1:55586821-55586843 GTCATGGGGGGCCTGTGACAGGG - Intergenic
908727530 1:67192895-67192917 GGCCTGAGGTGCATGTGAAAAGG - Intronic
910895724 1:92067168-92067190 CTCTAGGGGTGCCTGGGACAGGG + Intergenic
912964647 1:114227194-114227216 TTCCAAGGGTGCATTTGCCAGGG - Intergenic
913962070 1:143347822-143347844 GTCCAAGGGTACATGTGGAATGG + Intergenic
914056426 1:144173397-144173419 GTCCAAGGGTACATGTGGAATGG + Intergenic
914122720 1:144792965-144792987 GTCCAAGGGTACATGTGGAATGG - Intergenic
916679375 1:167090196-167090218 GCCCAGGGGTGGGTGAGACATGG - Intronic
917978917 1:180257403-180257425 GTGAATGTGTGCATGTGACATGG + Intronic
920660119 1:207908500-207908522 GTCCAGGGCTACATGTAAGAGGG - Intronic
922028864 1:221779332-221779354 GTCAAGGGGTGCATGGACCATGG + Intergenic
922359742 1:224810508-224810530 GGCCAGGAGTGCATGTGGGAGGG + Intergenic
1064824835 10:19386320-19386342 CTCCAGAGGTTCATGTGGCAGGG + Intronic
1065162651 10:22938970-22938992 GTCCTGGGTGACATGTGACATGG + Intronic
1065456505 10:25911740-25911762 ATCCAGATGTGCATGTGACGTGG + Intergenic
1068739115 10:60448895-60448917 ATCCAGGGATTCATGGGACAAGG - Intronic
1069933998 10:71902577-71902599 GTCCAGGAGGGCATGTGAGGTGG - Intergenic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1073958883 10:108903339-108903361 GTACAGGGGAGCATGTGCCTAGG + Intergenic
1075423688 10:122325526-122325548 GCCCAGGACAGCATGTGACAGGG + Intronic
1076060985 10:127413706-127413728 GTCTAGAGGTGGATGTGAGAGGG + Intronic
1076770891 10:132663956-132663978 TTCCTGGGCTGCGTGTGACACGG - Intronic
1077472424 11:2770272-2770294 GCCCAGGGCTGCCTGTGCCAGGG - Intronic
1077501896 11:2913067-2913089 GTGCAGGGGTGTTTGTAACAGGG + Intronic
1077776388 11:5276492-5276514 GTTCTGGGGTACATGTGCCATGG - Intronic
1081976428 11:47238264-47238286 GCCCTGGGGTGAATGTGGCAGGG - Intronic
1083602061 11:63954822-63954844 GTCCAAGTGTGTATGTGTCAGGG - Exonic
1086745590 11:90422896-90422918 AAGCAGGGGTGTATGTGACACGG + Intergenic
1087700664 11:101432987-101433009 ATTCAGGGCTGCATGTGAGAAGG + Intergenic
1087895217 11:103578946-103578968 CTACAGGGGTCCATGTGAGAGGG - Intergenic
1089783569 11:120892098-120892120 GGGCAGGGGTTCATGTGGCAAGG + Intronic
1091201665 11:133785216-133785238 TTCCAGGGGTACATGTGGTAGGG - Intergenic
1092940933 12:13406230-13406252 GACCAGGGGTGCATCTGCCATGG + Intergenic
1096317581 12:50581994-50582016 GTCCAGGGCTGCCTGAGACAAGG - Intronic
1096912078 12:54994582-54994604 GTTCAGGGGTACATGTTACATGG + Intergenic
1099574404 12:84362152-84362174 GGCCAGGGCTGCATGTTCCAAGG + Intergenic
1102702135 12:114848700-114848722 GTCCAGGTGCCCATGTGAGAAGG + Intergenic
1102990458 12:117311951-117311973 GTCCAGGGGTTCATGGTACATGG - Intronic
1104350967 12:128043695-128043717 ATCCAGGGGTGGAGGTCACAGGG - Intergenic
1104434635 12:128746072-128746094 GTCCAGGAGTGAATGAGACGCGG - Intergenic
1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG + Intronic
1104956086 12:132466527-132466549 GACCATGGGTGCCTGTGACCAGG + Intergenic
1106541965 13:30698389-30698411 GCCCAGAGGTGCCTGTGACATGG + Intergenic
1107879148 13:44817820-44817842 GTTCAGGGCTGCTTGTGACATGG - Intergenic
1108470075 13:50758705-50758727 GTGGAGAGGTTCATGTGACAAGG - Intronic
1113119932 13:106915387-106915409 GCCTAGGAGTTCATGTGACAAGG + Intergenic
1113754353 13:112799541-112799563 GTCCAGGGGGGAATGTCACAAGG + Intronic
1113796719 13:113062529-113062551 GTGCAGGGGAGCCTGTGGCATGG - Intronic
1113796944 13:113063931-113063953 GTGCAGGGGAGCCTGTGGCATGG + Intronic
1116409356 14:44603137-44603159 ATCCTGGGGTGAAGGTGACATGG + Intergenic
1121042403 14:90759851-90759873 GCACAGGGGTGCCTGTGACGGGG - Intronic
1121096829 14:91223252-91223274 ATACAGTGGTGAATGTGACATGG - Intronic
1121190660 14:92026564-92026586 GTCCACGGCTGCGTCTGACATGG - Intronic
1124557776 15:30743679-30743701 GGACAGAGGAGCATGTGACATGG + Intronic
1124581323 15:30957846-30957868 GCCCAGGGGTGGAGGAGACATGG + Intronic
1124641124 15:31397262-31397284 GGGCAGGGGTGCACGTGGCAGGG + Intronic
1124673461 15:31661979-31662001 GGACAGAGGAGCATGTGACATGG - Intronic
1125073018 15:35578577-35578599 CTCCAGGTGTGCATGTGTGAAGG + Intergenic
1125741523 15:41968216-41968238 GGGCAGGGGTGCATGTGCAAGGG - Intronic
1128228307 15:66018021-66018043 GTCAAGTGGTGAATGTGAGAGGG + Intronic
1128240054 15:66095703-66095725 GACCAGTGGGGCATGTGAAATGG - Intronic
1132419712 15:101654949-101654971 GTCCTGGGGTGCAGATGAGAGGG + Intronic
1133678514 16:8098520-8098542 CTGCAGGGGTGCATTTGAGATGG - Intergenic
1134482188 16:14629821-14629843 CTCGAGGGGTGCATGGGTCAGGG + Intronic
1136412099 16:30083576-30083598 GCCCAGGGCTCCATGGGACAGGG + Intronic
1136685183 16:31989856-31989878 GGGCTGGGGTGCAGGTGACAGGG + Intergenic
1136785794 16:32933391-32933413 GGGCTGGGGTGCAGGTGACAGGG + Intergenic
1136867501 16:33769238-33769260 GTCCAGGGGTGGCACTGACACGG + Intergenic
1136883975 16:33920413-33920435 GGGCTGGGGTGCAGGTGACAGGG - Intergenic
1203088028 16_KI270728v1_random:1195053-1195075 GGGCTGGGGTGCAGGTGACAGGG + Intergenic
1143914025 17:10275703-10275725 GTGGAGGTGTGGATGTGACAGGG + Intergenic
1145276891 17:21436930-21436952 ATCCAGGGGTGGATGTGGCCAGG - Intergenic
1145314723 17:21722823-21722845 ATCCAGGGGTGGATGTGGCCAGG - Intergenic
1146273136 17:31497613-31497635 CTACAGGGGTGCACATGACAAGG + Intronic
1146789327 17:35742676-35742698 GGCCAGGGGAGCAGGGGACAGGG - Exonic
1146840898 17:36153421-36153443 TTCCTGGGGTGCTTGTGGCATGG + Intergenic
1146923641 17:36729807-36729829 CTCTATGGGAGCATGTGACAAGG - Intergenic
1147146126 17:38485537-38485559 GGGCTGGGGTGCAGGTGACAGGG + Intronic
1148335911 17:46841434-46841456 GCCCAGAGGTGCCTGGGACAGGG - Intronic
1149092879 17:52804920-52804942 GAGCTAGGGTGCATGTGACAGGG - Intergenic
1149858631 17:60107547-60107569 TTCCTGGGGTGCTTGTGGCATGG - Intergenic
1150633096 17:66894033-66894055 GTCCAGCGGTGTAGGTGCCAGGG + Intergenic
1151142752 17:72010657-72010679 GCCAAGGGGTGCAGGTGACCCGG + Intergenic
1152191910 17:78893297-78893319 GTGCAGGGGTGTATGTGCAAGGG + Intronic
1154086663 18:11312273-11312295 GTCCAGGGGTGCAAATAACTGGG + Intergenic
1157891680 18:51424110-51424132 TTTCAGGGGAGCATGTGAAATGG + Intergenic
1158137484 18:54223909-54223931 GGCCCGGGGGGCATGTGGCAGGG - Intronic
1160283639 18:77518172-77518194 GTGCAGTGGTGCAGGGGACACGG + Intergenic
1160589650 18:79936182-79936204 GTGCAGGGGTGATAGTGACAGGG + Intronic
1162878026 19:13635442-13635464 GTCCAGGGGTGTAGGAAACACGG + Intergenic
1164219046 19:23177127-23177149 GTCCAGGGGAGAATGTCACAAGG - Intergenic
1164431123 19:28189721-28189743 GTACCAGGGTGCATGTTACAAGG + Intergenic
1164535882 19:29086362-29086384 GTGCTGCGGTGCATGTCACAGGG + Intergenic
1164587178 19:29483369-29483391 GAGCAGGGGTGGATGTGAGAGGG + Intergenic
1166265733 19:41683125-41683147 GTCCAGGGATCCATGTACCACGG + Intronic
1166411357 19:42557531-42557553 GTCCGGGGGGGAATGTCACAAGG - Intronic
1166667514 19:44689822-44689844 GACCAGGGGTGAAGGTGAGAGGG - Intergenic
1168520981 19:57050324-57050346 GTTCAGGGATACATGTGCCATGG - Intergenic
1202695907 1_KI270712v1_random:126074-126096 GTCCAAGGGTACATGTGGAATGG + Intergenic
925250268 2:2428298-2428320 GTGCAGGTCTACATGTGACAGGG + Intergenic
925891500 2:8438623-8438645 GCCCAGGGGTGCATGCATCAGGG - Intergenic
926726694 2:16004282-16004304 GTCCAGGGCTGCATGAGATGTGG + Intergenic
929206833 2:39305672-39305694 GTACAGGGGAGCATTTGACAGGG - Intronic
930479017 2:51923883-51923905 GTGGAGGGGTCCATGTGGCAAGG + Intergenic
930557240 2:52913718-52913740 GTCCATGGGTGCTTATGAAATGG - Intergenic
930694999 2:54402410-54402432 GTCCAGCTGTGCCTGTGACTGGG - Intergenic
931282303 2:60804846-60804868 GGCCAGGGCTGCGTGTGCCATGG - Intergenic
934277071 2:91583122-91583144 GTCCAAGGGTACATGTGGAATGG + Intergenic
938323750 2:130383356-130383378 GACCAGGGCTGCATGTCAGAGGG + Intergenic
939624470 2:144460031-144460053 GGCCAGGGCTGCATAAGACAGGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
947500487 2:230667617-230667639 GTCCAGGGTTTCCTGGGACAAGG + Intergenic
1169316947 20:4600619-4600641 GTCTAGGGGTGCAATTGTCAAGG + Intergenic
1171243152 20:23587567-23587589 ATTCAGAGGTGCATGTCACATGG + Intergenic
1171253764 20:23670510-23670532 TTCCAGGGCTTCATGTGGCAGGG - Intergenic
1171489785 20:25508729-25508751 GTGCAGGGATGCAGGTGACTGGG - Intronic
1173552158 20:43940031-43940053 GTCCAGGGGTGTATGGGGCTTGG + Intronic
1175869036 20:62198771-62198793 GTCCAGGGGTACAGGTCACAGGG - Exonic
1177775292 21:25560546-25560568 GTGCAGTGGGGCATGTGGCAAGG - Intergenic
1178942011 21:36914228-36914250 GTGCAGGGCTGGATGTGAGAGGG - Intronic
1179904714 21:44416478-44416500 CTCCAGGGGTGCATGTGGAAGGG - Intronic
1184191657 22:42899002-42899024 GTCCAGAGGTGCCTTTCACAAGG + Intronic
1184235313 22:43180113-43180135 GGCCTGGGGTACATGTGAGAGGG - Intronic
1185049921 22:48548631-48548653 GTTCAGGGCTGCATTTCACAGGG + Intronic
1185337754 22:50278349-50278371 GGGCAGGGGTGCATGTGTCCAGG + Intronic
950240573 3:11366313-11366335 GTCCAGGATTACATCTGACACGG + Intronic
954745498 3:52785356-52785378 GGCCTGGGGTGTATGTGGCATGG - Intronic
958418603 3:93906575-93906597 GGCCAGGGCTGCACGTGCCATGG + Intronic
968880945 4:3299868-3299890 GTCCAGGGGTCCAGGGGTCATGG - Intronic
968950001 4:3685637-3685659 GTCCATGGGTTCATGTGACCTGG + Intergenic
969033683 4:4233256-4233278 GTCCAAGGGTACATGTGGAATGG - Intergenic
970000669 4:11363122-11363144 GTCCAGGTGTGCAAATGATAGGG - Intergenic
976938215 4:90666040-90666062 ATTGAGGGGGGCATGTGACAAGG - Intronic
977421009 4:96799473-96799495 GTCCTGGGCTGCATGTGGCCTGG - Intergenic
978075703 4:104527077-104527099 GTTCAGGGGTACATGTGCCATGG + Intergenic
981807194 4:148730660-148730682 GTGTAGGGCTTCATGTGACAAGG - Intergenic
982659814 4:158193074-158193096 GTCCTGGGCTGCATGTGGCCTGG - Intergenic
983872121 4:172834642-172834664 CTCCAAGGGTGCATTTGTCAGGG - Intronic
984183587 4:176515045-176515067 TTCTAGTGGTGCTTGTGACACGG - Intergenic
985401911 4:189601331-189601353 GGCAAGGGGTGCATGCTACAAGG + Intergenic
985964906 5:3332457-3332479 GGCCACGGGTGCATGTTCCATGG - Intergenic
987693598 5:21299892-21299914 TACCAGGGGTACAAGTGACATGG + Intergenic
991746671 5:69749654-69749676 TACCAGGGGTACAAGTGACATGG - Intergenic
991751034 5:69805588-69805610 TACCAGGGGTACAAGTGACATGG + Intergenic
991798273 5:70329597-70329619 TACCAGGGGTACAAGTGACATGG - Intergenic
991826049 5:70624966-70624988 TACCAGGGGTACAAGTGACATGG - Intergenic
991830321 5:70680483-70680505 TACCAGGGGTACAAGTGACATGG + Intergenic
991890608 5:71328913-71328935 TACCAGGGGTACAAGTGACATGG - Intergenic
994683109 5:102914402-102914424 TTCCAGGGGAACATGTTACATGG - Intronic
995594809 5:113736260-113736282 TTCCAGGGGTACATGTTACATGG + Intergenic
995964844 5:117892376-117892398 GTCCAACTGTGTATGTGACATGG - Intergenic
995973396 5:118001233-118001255 GCCCAGGGGTGCCTTTCACATGG - Intergenic
998005392 5:138653595-138653617 GGCCAGGTATGCATTTGACAAGG + Intronic
998913926 5:146994115-146994137 GGCCAGTTGGGCATGTGACAGGG + Intronic
999829796 5:155307640-155307662 GTCCTGGGAGGCATCTGACAGGG + Intergenic
1000544949 5:162587853-162587875 GTCAAGGGGTACATGTGCCACGG + Intergenic
1002272256 5:178080246-178080268 GCCAATGGGTGCATGAGACAAGG - Intergenic
1005557311 6:27000046-27000068 TACCAGGGGTACAAGTGACATGG - Intergenic
1014090638 6:117400146-117400168 GTCCAGGTGTCTATGTGACCAGG - Intronic
1018974624 6:168555571-168555593 GTCCACGGCCGCATGTTACAAGG + Intronic
1018987332 6:168647848-168647870 GTCCTGGGGTGACTGTGACATGG + Intronic
1019139840 6:169936293-169936315 GGCCAGGGGTGAATGTGAGTTGG - Intergenic
1020111191 7:5448646-5448668 GTCCAGGGGTGGATCTGGCCTGG - Intronic
1023048441 7:36231136-36231158 GTCCAGGACGGCATGGGACACGG - Intronic
1023732549 7:43205994-43206016 GTCCAGGGGAGGAAGTGGCAGGG - Intronic
1024458920 7:49639526-49639548 GTCCAGAGGTGCATGTCCAAAGG + Intergenic
1024609958 7:51055637-51055659 GCCCAGGGGTGCATGTTCCCAGG + Intronic
1026377687 7:69768530-69768552 GTCCAGAGCTGCATGTGTTAAGG - Intronic
1028744302 7:94309815-94309837 GGACAGGGGGGCATGTGACAGGG - Intergenic
1030116182 7:106064024-106064046 GTGCATGGGTGCATGTCACTAGG - Intergenic
1032092793 7:128919974-128919996 GTACAGTGGTGAATGAGACAGGG + Intergenic
1035079591 7:156204849-156204871 TTTCAGGTGTGCATGTGCCAGGG - Intergenic
1035622513 8:1044544-1044566 GTCAAAGTGTGCATGTGACCTGG + Intergenic
1036936525 8:13007577-13007599 GGGAAGGGGTGCATGTCACATGG + Intronic
1037917964 8:22784180-22784202 TTGCAGGGGTGCTGGTGACAGGG - Intronic
1042972115 8:74420866-74420888 GTTCTGGGGTACATGTGCCATGG + Intronic
1043068980 8:75614084-75614106 GACCAGGGATGCAGGTGACCAGG - Intergenic
1044373705 8:91445035-91445057 GTGCAGGGGTGCATGCCATAGGG + Intergenic
1045242069 8:100411250-100411272 GTGCAGGTGTGCATGTGAAGAGG + Intergenic
1047287809 8:123503397-123503419 GTCCTGGGGTGAAAGTGAAACGG + Exonic
1048911742 8:139141748-139141770 GTTCAGGGAAACATGTGACATGG - Intergenic
1053283578 9:36836809-36836831 CTCCAGGGGTCCAGGTGCCAAGG - Exonic
1056927036 9:90843986-90844008 GTCCAGGGGGGCATGAGTGATGG + Exonic
1057031920 9:91782656-91782678 GTCCTGGGCTGCATGTGCCACGG + Intronic
1058949690 9:109891847-109891869 GTCTATGGGTGCATATGAAAGGG + Intronic
1059003914 9:110380942-110380964 ATCCAAGGGTGCATGTGTCCAGG + Intronic
1059547478 9:115192800-115192822 GTCCTGACTTGCATGTGACATGG + Intronic
1062474097 9:136719071-136719093 CTCCAGGGGTGCATCTGATCGGG - Intronic
1203778709 EBV:88563-88585 GCCCAGGGGTGCCTATAACATGG - Intergenic
1185632870 X:1528326-1528348 ATGCAGGTATGCATGTGACAGGG + Intronic
1187046620 X:15653676-15653698 GTCCACAGTTGCATCTGACATGG + Intronic
1190908594 X:54751364-54751386 CTCCAGGGCTGCATGTGAGTGGG - Exonic
1196626998 X:117887993-117888015 GTCCAGGAGTCCTTGGGACATGG - Intergenic
1197720591 X:129742237-129742259 GTGCAGGGGTGCGTGGGGCAGGG - Intronic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1199684963 X:150257604-150257626 CCCTTGGGGTGCATGTGACAGGG - Intergenic