ID: 1104638517

View in Genome Browser
Species Human (GRCh38)
Location 12:130452560-130452582
Sequence CAGGCTACTCCCCTTCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104638512_1104638517 1 Left 1104638512 12:130452536-130452558 CCCAGCCGACAGCAGAGCCTGCT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG 0: 1
1: 0
2: 1
3: 15
4: 142
1104638511_1104638517 10 Left 1104638511 12:130452527-130452549 CCTCGGAAACCCAGCCGACAGCA 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG 0: 1
1: 0
2: 1
3: 15
4: 142
1104638510_1104638517 17 Left 1104638510 12:130452520-130452542 CCAGAAGCCTCGGAAACCCAGCC 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG 0: 1
1: 0
2: 1
3: 15
4: 142
1104638513_1104638517 0 Left 1104638513 12:130452537-130452559 CCAGCCGACAGCAGAGCCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 236
Right 1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG 0: 1
1: 0
2: 1
3: 15
4: 142
1104638514_1104638517 -4 Left 1104638514 12:130452541-130452563 CCGACAGCAGAGCCTGCTGCAGG 0: 1
1: 0
2: 9
3: 49
4: 481
Right 1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG 0: 1
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104638517 Original CRISPR CAGGCTACTCCCCTTCCAAC TGG Intronic
901005420 1:6169515-6169537 CAGGCTACTGCCGTCCCAGCAGG - Intronic
901454908 1:9357689-9357711 AAGGCCACTCCCCTTCCCAAAGG - Intronic
901667018 1:10831812-10831834 CAGGGGACTCCCCTTCCACCAGG + Intergenic
901926588 1:12570233-12570255 CAGGCTTCTCCTCGTACAACCGG + Intronic
902215281 1:14930841-14930863 CAGGGTTCCCCCCTCCCAACTGG - Intronic
903836038 1:26203830-26203852 CTGGGGACTCCCATTCCAACTGG - Intergenic
906627004 1:47333780-47333802 GAAGCTCCTCCCCTTCCGACAGG + Exonic
906862013 1:49371102-49371124 CAGGCTACTGGCCTTCAAAATGG + Intronic
908773517 1:67617503-67617525 CTGCATACTCCCCTTCCAAATGG + Intergenic
911947584 1:104132173-104132195 CAGGCTCCTGCCTTTTCAACAGG + Intergenic
912757944 1:112340202-112340224 CAGGCCACTCCTCTTCCCACAGG - Intergenic
913003625 1:114606877-114606899 CAGGCATCTCCCCTTCCCATGGG + Intronic
914995337 1:152538423-152538445 CAGCCTCCTCCCCTTCCTAATGG + Intronic
915301194 1:154952532-154952554 CTGCCTACTCCCCTTCCATAGGG + Intronic
916207379 1:162328427-162328449 AAGGCTACTCCTCTTCCAAATGG - Intronic
916437384 1:164789720-164789742 CTGGCTACTCCACACCCAACTGG - Intronic
918175543 1:182041114-182041136 CAGGCTCCTCCCCCTTCAAATGG + Intergenic
919921333 1:202168220-202168242 GAGGCCACTCCCTTTCCACCAGG + Intergenic
921095653 1:211885190-211885212 AAGGCTACTCCCCTTCCCTGGGG + Intergenic
923266651 1:232320860-232320882 AAAGCTACTCCCATCCCAACTGG - Intergenic
923320777 1:232830871-232830893 CAGGCTCCTCACCTTCCCCCAGG - Intergenic
1064002421 10:11674619-11674641 CAGGCTCCTCCCCTGCCTAAGGG - Intergenic
1066480935 10:35794961-35794983 CAGGCTCCTCTCCCTCCACCAGG - Intergenic
1068044731 10:51871696-51871718 CAGGTAACTCCTCTTCCCACAGG - Intronic
1069478223 10:68756251-68756273 CATGCTTCTTCCCTTGCAACAGG + Exonic
1070844339 10:79509624-79509646 CAGGCTTCTCCATTTCCAGCTGG - Intergenic
1070929458 10:80250684-80250706 CAGGCTTCTCCATTTCCAGCTGG + Intergenic
1072374952 10:94804626-94804648 CTGGCTACTCACCCTTCAACTGG - Intronic
1072665390 10:97389001-97389023 CAGGCAACTCCCCTTCCAGCTGG + Intronic
1073664081 10:105510248-105510270 CAGGCTCCTCCCCTGCTAAAAGG + Intergenic
1074509483 10:114099628-114099650 CACGCTACTCCACTTCCAGCAGG - Intergenic
1074615370 10:115062055-115062077 CAGGCTCTTCCTCCTCCAACTGG + Intergenic
1078241105 11:9531363-9531385 CAGGTGTCTCCCCTTCCCACAGG - Intergenic
1078813137 11:14791772-14791794 CAGGCCCCTCCCCTTCCCATGGG + Intronic
1080687543 11:34527712-34527734 CATGCCACTGCCCTTCAAACTGG + Intergenic
1088107634 11:106224349-106224371 CATGCTATCCACCTTCCAACAGG + Intergenic
1089178055 11:116562425-116562447 CAGTCTACTCCTCTTCAAAAGGG + Intergenic
1089356433 11:117857009-117857031 CAGGCTACCCCCCTTCCCTTTGG - Intronic
1089635779 11:119810671-119810693 CCGGGGACTCCCCATCCAACAGG - Intergenic
1091029154 11:132168793-132168815 CGGGCTCCTCCCTTTCCTACAGG - Intronic
1092259649 12:6946148-6946170 GAGGCTCCTCCCCTTCCCCCGGG + Intergenic
1092729147 12:11512102-11512124 CAGACTACTATCCTTCTAACTGG + Intergenic
1096707276 12:53430150-53430172 CAGTCCACCACCCTTCCAACTGG + Exonic
1097881675 12:64691967-64691989 CAGGCTAATTCCCTTCTAAAGGG + Intronic
1099358986 12:81674617-81674639 CAGGCTACTGCACTCCCATCTGG + Intronic
1100271556 12:93029948-93029970 CAGGCTCCTCCCCCTGCAAATGG - Intergenic
1100793018 12:98151405-98151427 CAGGCTTCTCTCCTTCCAGTGGG - Intergenic
1102488936 12:113277187-113277209 CAGGCTACTCCCCTTCCCTTGGG - Intronic
1102505475 12:113381709-113381731 CAGGAAACTTCCCTTCCATCAGG + Intronic
1102936513 12:116901831-116901853 CAGGCTCATCCCGTTCCAGCAGG - Intergenic
1104416899 12:128603075-128603097 CAGGCTTCTCCCCTCTCCACAGG + Intronic
1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG + Intronic
1104790589 12:131479556-131479578 CAAGCACCTCCCCTTCCAGCAGG + Intergenic
1106203251 13:27562511-27562533 CAGCCAACCCCCCTTCCAACAGG + Exonic
1109466390 13:62738529-62738551 CAGGATACTGCCCCTCCAACTGG + Intergenic
1116991742 14:51284549-51284571 CTCTCTACTCCACTTCCAACAGG + Intergenic
1117217559 14:53567689-53567711 AAGGCTCCTCCCCTCCCCACAGG - Intergenic
1117847383 14:59925484-59925506 AGGGCTCCTCCCCTTCCAAATGG - Intronic
1120559088 14:85969182-85969204 CAGGCCCCTACCCTGCCAACAGG + Intergenic
1122017341 14:98807545-98807567 CAGGCTCCTCCCCTATAAACAGG - Intergenic
1122301338 14:100732843-100732865 CAGGCTAAGCCCCATCCAGCGGG - Intronic
1122902735 14:104788502-104788524 CAGGCCACTCCCCTTCATCCTGG - Intronic
1124366691 15:29076948-29076970 CAGGCTAATCCAGTTCCAATTGG + Intronic
1124955843 15:34359821-34359843 CAGGCTCCTCCTCTTCCAAAAGG + Intronic
1126943679 15:53793406-53793428 CAGTGTACTCCCCTTCAAATTGG - Intergenic
1128776323 15:70323267-70323289 CAGGCTCCGCTCCTTCCAGCAGG + Intergenic
1129859752 15:78851364-78851386 CAGGCAAGTCTCCTTCCCACTGG - Intronic
1132432859 15:101774871-101774893 CTGGCACCTCCCCTCCCAACAGG + Intergenic
1140059482 16:71555498-71555520 CAAGCTGCTCACCCTCCAACTGG - Intronic
1142146683 16:88495745-88495767 CTGGCCACTCACCTTCCATCCGG - Intronic
1144546151 17:16197770-16197792 CTGGCTTTTCCCCTTCCACCTGG - Intronic
1144581703 17:16462959-16462981 CAAGCTGCTCCCCTCCCATCGGG - Intronic
1146359027 17:32159333-32159355 CACACTGCTCCCCTGCCAACGGG - Intronic
1150245624 17:63672683-63672705 CAGGCTCATCCTCTTCTAACTGG - Intronic
1150703746 17:67469482-67469504 CAGGCTTCTCCCTTGTCAACAGG - Intronic
1151003170 17:70401832-70401854 CAGGCTGCTCCCCTTTCCAGGGG + Intergenic
1155217580 18:23657029-23657051 CAGGCCACTGCCCCTCCATCAGG + Intronic
1162079867 19:8211345-8211367 CAAGCTTCTCCCTTTCCGACTGG + Intronic
1162796553 19:13090311-13090333 CAGGCGCCTCCTCTGCCAACCGG + Exonic
1163326488 19:16606718-16606740 CAGCCTACTCCCCTCCCAGATGG - Intronic
1163977517 19:20866231-20866253 CATGCAACACCCCTTCCAAATGG - Intergenic
1164681272 19:30135267-30135289 TGGGCCACTCCCCTTCCATCTGG + Intergenic
1164737517 19:30552771-30552793 CAGGCGTCTCCCCACCCAACTGG - Intronic
1164913133 19:32028176-32028198 CAGGCTCCTTCTCATCCAACAGG + Intergenic
1165471883 19:36008812-36008834 CTGGCTCCGCCCCTTCCAAGAGG + Intergenic
926958996 2:18332912-18332934 CGGGCTGCTCCCCTACCAGCAGG + Intronic
927154834 2:20215548-20215570 CAGACTGCACCCCTTCCCACAGG + Intronic
928733694 2:34261464-34261486 CAGGCTACCCACCTCCCAGCTGG - Intergenic
936227919 2:110674744-110674766 CAGACTCCTGCCCTTCCAGCAGG + Intronic
936428408 2:112437530-112437552 CAGGCTCCTCCCCCGCCCACGGG + Intergenic
938163970 2:129010060-129010082 CAGCCCACTGTCCTTCCAACAGG + Intergenic
943743770 2:191439647-191439669 CAGGCTTCTCCCATTTCAAAGGG + Intergenic
945825594 2:214716914-214716936 CAGGCTACCCGCCTCCCAGCTGG - Intergenic
946652952 2:221913881-221913903 CAGGCTCCTCCCCCTGCAAAGGG + Intergenic
948693575 2:239721650-239721672 CAGGCTACTCCCCTGCCTGGGGG + Intergenic
1170721069 20:18879547-18879569 CAGGCTACTCGCCTCCCAGCTGG + Intergenic
1172029192 20:31969362-31969384 AAGGGTCCTCCCCTTCCAACAGG + Intronic
1175571573 20:60026681-60026703 CAGGCTGCACTCCTTCCTACAGG - Intronic
1177195633 21:17901105-17901127 CAGGCTACCCACCTCCCAGCTGG + Intergenic
1180188151 21:46150609-46150631 CAGGCTCCTCCCCGTCCAGCTGG - Intronic
1183282548 22:36939438-36939460 CAGGCAACTCTCCCTCCCACCGG + Exonic
1185032218 22:48450149-48450171 CTGGCTTCTCCACTTCCCACCGG - Intergenic
950603594 3:14058037-14058059 CAGGCTACCCACCTCCCAGCTGG + Intronic
953619242 3:44518591-44518613 CAGGCTTCTCTCCTTCCTACGGG - Intergenic
954056572 3:48030955-48030977 CAAGATACTCCACTTCCAAGAGG + Intronic
956950223 3:74273886-74273908 CAGGCTACCCACCTCCCAGCTGG - Intronic
958796329 3:98710106-98710128 CAAGTTCATCCCCTTCCAACTGG - Intergenic
959186113 3:103049964-103049986 CAGGCTGCTTCCCATCCATCGGG - Intergenic
959498267 3:107076174-107076196 CAGCCTACTCCCCCACCTACTGG + Intergenic
960240576 3:115337004-115337026 CAGACTACTCCCAGTCCAGCAGG - Intergenic
962126721 3:132627180-132627202 CAGGCTCCTCCCCTTGCATAAGG - Intronic
963069372 3:141290333-141290355 CAGGCTCCTCCCCATGCTACAGG - Intronic
963381413 3:144534949-144534971 CAGGGTTCTACCCTTCCAAAGGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966310653 3:178589778-178589800 CAGGTCACTACCCTTCCAAATGG - Intronic
968359770 3:198138795-198138817 CAGGCTGTTCCCCATCCAGCAGG + Intergenic
969344235 4:6561189-6561211 CAGGCATTTCCCCTTCCCACAGG - Intronic
971873636 4:32276036-32276058 CTGCCTACTCCCCTTCCCGCAGG - Intergenic
973876898 4:55229319-55229341 AAGAGTCCTCCCCTTCCAACTGG - Intergenic
982129971 4:152220216-152220238 CAGGCTACTCTCCTGCCAAGAGG + Intergenic
983517653 4:168674453-168674475 CTGGCAACTCCTCTTTCAACAGG - Intronic
983852954 4:172605943-172605965 CAGGCTCCTCCCCTTGCATAAGG + Intronic
990005256 5:50938102-50938124 CATGCTTCTCTCCTTCCAAGTGG - Intergenic
990190013 5:53249313-53249335 TAGGCATCTCCCCTTCCCACTGG + Intergenic
991083020 5:62621431-62621453 CAGGCTCCTCCCCCTGCAAATGG + Intronic
991631157 5:68657416-68657438 CAGGCCAAGCCCCTTCCACCAGG - Intergenic
991923831 5:71684153-71684175 CAGGCTACCCACCTCCCAGCTGG - Intergenic
995850133 5:116536206-116536228 AAGGCTAATCCAATTCCAACAGG - Intronic
997242063 5:132314957-132314979 GAGGCTGCTCCCCTTCCTGCAGG + Intronic
1002421283 5:179150320-179150342 CCAGCTATTCCCCTTCCCACAGG - Intronic
1003160884 6:3633363-3633385 CAGGCTCCTCCCCTGCCCAGAGG - Intergenic
1003674212 6:8188266-8188288 CAGGCTGTCCCCCTACCAACAGG + Intergenic
1009613730 6:65978879-65978901 TAGGCTTCTCTCCTTCCTACAGG + Intergenic
1019260218 7:77855-77877 CAGGCTGTTCCCCATCCAGCAGG - Intergenic
1021242539 7:18221444-18221466 AATGCTACTCCCTTTCCAGCAGG - Intronic
1021574330 7:22093898-22093920 CAGGCATCTCCCCTTCCCAGGGG + Intergenic
1023176689 7:37442422-37442444 AAGTATATTCCCCTTCCAACTGG + Intronic
1025157387 7:56620602-56620624 CAGGCTCCTCCCCTGCCAAGAGG - Intergenic
1025848031 7:65217750-65217772 CAGGCTACTCCCCGTCTCTCTGG + Intergenic
1029956896 7:104649645-104649667 CAGTCTTGTGCCCTTCCAACAGG - Intronic
1031871098 7:127091138-127091160 CAGGATTCTCTCCTTCCTACAGG + Intronic
1035031863 7:155866006-155866028 CAGGCTGCTCGCCCTCCACCAGG - Intergenic
1035056346 7:156039198-156039220 CAAGCTTCTCCCTTTCCCACAGG + Intergenic
1035268042 7:157703074-157703096 CAGGATACTCCCTTTGCCACAGG - Intronic
1036209206 8:6828453-6828475 CGGGCTAGTCACCTTCCCACTGG - Intronic
1037901375 8:22691346-22691368 CCTTCGACTCCCCTTCCAACTGG - Exonic
1040374500 8:46810831-46810853 CAGGCTCCTCCCCTGCCAAAAGG + Intergenic
1046067133 8:109210886-109210908 CTGGCTACTCCTCTTCCCATGGG + Intergenic
1047555959 8:125930623-125930645 CAGACTTCTCCCCTCCCTACAGG - Intergenic
1049709920 8:144058861-144058883 CAGGCTGCTGCACTTCCAGCAGG + Exonic
1060348746 9:122839044-122839066 GTGGCTACTCCCCTACCAGCTGG + Intergenic
1062030739 9:134360835-134360857 CAGGCTTCTCCACTACCCACTGG - Intronic
1062744473 9:138202616-138202638 CAGGCTGTTCCCCATCCAGCAGG + Intergenic
1187094348 X:16130592-16130614 CAGGGTAATCCCCTTCTAATGGG + Intronic
1189534662 X:41923719-41923741 CAGGCTCCGCCCACTCCAACCGG + Intergenic
1192447995 X:71224682-71224704 CTGGCTACTTCCCTTCCTCCCGG + Exonic
1196531771 X:116796310-116796332 CTGGCTACTCTCCTTTGAACAGG + Intergenic
1200852095 Y:7893801-7893823 CAGGCTCCTGCCCTGCCAAAAGG - Intergenic
1201372314 Y:13278799-13278821 CAGGCTTCTCCCCAGCCAAGGGG - Intronic