ID: 1104638896

View in Genome Browser
Species Human (GRCh38)
Location 12:130454816-130454838
Sequence CTGTGGGCCTCGGACTCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 195}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104638884_1104638896 21 Left 1104638884 12:130454772-130454794 CCTCCCTGTCCCGGGAGCTTTGC 0: 1
1: 0
2: 2
3: 43
4: 198
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638890_1104638896 11 Left 1104638890 12:130454782-130454804 CCGGGAGCTTTGCAGCGGGTTCC 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638882_1104638896 25 Left 1104638882 12:130454768-130454790 CCCGCCTCCCTGTCCCGGGAGCT 0: 1
1: 0
2: 1
3: 61
4: 399
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638885_1104638896 18 Left 1104638885 12:130454775-130454797 CCCTGTCCCGGGAGCTTTGCAGC 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638889_1104638896 12 Left 1104638889 12:130454781-130454803 CCCGGGAGCTTTGCAGCGGGTTC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638886_1104638896 17 Left 1104638886 12:130454776-130454798 CCTGTCCCGGGAGCTTTGCAGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638893_1104638896 -10 Left 1104638893 12:130454803-130454825 CCACATTCACATGCTGTGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195
1104638883_1104638896 24 Left 1104638883 12:130454769-130454791 CCGCCTCCCTGTCCCGGGAGCTT 0: 1
1: 0
2: 6
3: 35
4: 350
Right 1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG 0: 1
1: 0
2: 2
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104638896 Original CRISPR CTGTGGGCCTCGGACTCACC GGG Intronic
900291640 1:1926209-1926231 GGGTGGGCCTGGGACTCACCAGG + Exonic
900906799 1:5565017-5565039 CTGTGGGCCTCAGTCTCACCGGG - Intergenic
900949156 1:5847840-5847862 CTGTCTGCCTCGGCCTCCCCAGG - Intergenic
904478183 1:30777792-30777814 CTGGGGGCCGGGGGCTCACCAGG - Intergenic
904500363 1:30909296-30909318 CTCTGGGCCTCGGTCTCCCCAGG + Intergenic
905849808 1:41265309-41265331 CTGGGGGCCCTGGACTCTCCCGG + Intergenic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
906260155 1:44380771-44380793 CTGTGGGCCTGGGACTTACCAGG - Intergenic
912312347 1:108635359-108635381 CTGTGTGCCTTGGAAGCACCTGG + Exonic
912419927 1:109535997-109536019 CTGGGGGCCTCGGATGAACCAGG - Intergenic
912507656 1:110167159-110167181 CTGTGGGCCTCGGCAACATCTGG + Exonic
912981739 1:114380112-114380134 CTGTGGAACTCCCACTCACCAGG + Intergenic
913181634 1:116328154-116328176 CAGTGTGCCTCAGAATCACCTGG + Intergenic
915275854 1:154787718-154787740 CTGTGGGCTTCTGACTCCACGGG - Intronic
915584531 1:156837204-156837226 CTGTGTACCAGGGACTCACCAGG + Intronic
916073660 1:161187417-161187439 CTGTGGTCCTCCTACTAACCAGG - Exonic
918045980 1:180941282-180941304 CTGGGGCCCCTGGACTCACCGGG - Exonic
919183656 1:194117667-194117689 CTGTGTGCCTGGTATTCACCTGG + Intergenic
920039095 1:203084507-203084529 CTTTGGGCCTTGGAGTCAGCAGG + Intronic
920211689 1:204333117-204333139 CTGGGGGCCTCTGGCTCTCCTGG - Intronic
920261191 1:204689113-204689135 CAGTGGACCTTGGAATCACCTGG + Intergenic
921065237 1:211617871-211617893 CTCTGGGCCTCAGTCTCATCAGG + Intergenic
921932480 1:220765978-220766000 CTGTGGGCATGAGATTCACCTGG - Intronic
1068222737 10:54064396-54064418 CTCTGGGCCACGGACTCCACTGG + Intronic
1069802970 10:71093689-71093711 CTGTGGGTCTGGGCCTGACCTGG + Intergenic
1070298852 10:75188235-75188257 CTGGGAGCCTCAGCCTCACCTGG - Intergenic
1070873504 10:79779500-79779522 TTGTGTGCCGCGGACTGACCGGG - Intergenic
1071640434 10:87301650-87301672 TTGTGTGCCGCGGACTGACCGGG - Intergenic
1071654801 10:87436295-87436317 TTGTGTGCCGCGGACTGACCGGG + Intergenic
1073102061 10:101011671-101011693 CTCTGGGACTCTGACTGACCAGG + Intronic
1073291176 10:102414024-102414046 CTGGAGGCCTTGGCCTCACCTGG - Exonic
1075933225 10:126317225-126317247 CTGTGTTCCTCGGCCTCACCTGG - Intronic
1076830394 10:132991546-132991568 CTGTGGCCCCAGGACTGACCAGG + Intergenic
1076946506 10:133655409-133655431 CTGTGGCCCTCAGATGCACCTGG + Intergenic
1077160183 11:1109165-1109187 CTGTGGCCCTGGGCCTCACCAGG + Intergenic
1077327675 11:1970720-1970742 CTGTGGGCCGCAGACTCAGAAGG + Intronic
1077419036 11:2440955-2440977 CTGTGGGCCTCTGACCCTGCTGG + Intergenic
1083808788 11:65090715-65090737 CTGTGGGTCTTGGGCTGACCTGG - Intronic
1083853516 11:65380866-65380888 CTCTGGGCCTCTGCCCCACCTGG - Intronic
1085322731 11:75584493-75584515 CTGAGGGCCTCCGAGACACCCGG - Intergenic
1085442959 11:76579832-76579854 CTGTGTGCCTGGTACACACCAGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1088919559 11:114251239-114251261 CTGAGGGGCTGGGACTCCCCTGG - Intergenic
1202810657 11_KI270721v1_random:25900-25922 CTGTGGGCCGCAGACTCAGAAGG + Intergenic
1092205558 12:6612763-6612785 CTGCAGGCCCCGGACTCACAGGG + Intergenic
1096215011 12:49793772-49793794 CTGTGGGCCCCGGAATGGCCTGG - Exonic
1098150622 12:67542791-67542813 CTCTACGCCTCTGACTCACCTGG - Intergenic
1101270073 12:103133484-103133506 CTGGGGCCCAAGGACTCACCTGG + Intergenic
1103302571 12:119939340-119939362 GTGTGGGCATCAGTCTCACCTGG + Intergenic
1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG + Intronic
1104721740 12:131048292-131048314 CTGTGAGTCTCGCACTCCCCAGG + Intronic
1105378515 13:19864795-19864817 CTGTGGGGCCCGCCCTCACCGGG - Intergenic
1108797024 13:54044175-54044197 CTGTGGGTGTGGGACCCACCAGG - Intergenic
1113578997 13:111414705-111414727 ATGAGGGCCACGGACTCACCTGG + Intergenic
1113583772 13:111448811-111448833 CTGTGGGGCTGGCACCCACCTGG - Intergenic
1113744278 13:112732000-112732022 CTGCGGGCCACTGTCTCACCTGG - Intronic
1118048087 14:61994316-61994338 CCGTGGGTGTCAGACTCACCTGG + Intergenic
1118247519 14:64125734-64125756 CTGTGGCTCCCAGACTCACCAGG + Intronic
1121709866 14:96029944-96029966 GAGTGGGCATCAGACTCACCTGG + Intergenic
1122632725 14:103114303-103114325 CTGGGGGCCTGGGCCTCTCCAGG + Intergenic
1202920613 14_KI270723v1_random:28031-28053 CTGTGGCCCTCAGATGCACCTGG + Intergenic
1202924318 14_KI270724v1_random:9617-9639 CTGTGGCCCTCAGATGCACCTGG - Intergenic
1124358839 15:29019232-29019254 CTGTGGGGCTGGGCCTCACACGG + Intronic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1127253879 15:57271371-57271393 CCGTGGGCCTGGGACCCACCAGG + Intronic
1127480520 15:59372776-59372798 CCGAGCGCATCGGACTCACCTGG - Exonic
1128876631 15:71207254-71207276 CTGTGAGCCTCTGATTCACTTGG + Intronic
1129168650 15:73794354-73794376 CTCAGGGCCTGGGCCTCACCTGG + Intergenic
1130098141 15:80871505-80871527 CTGTGGACCTCAGACTTCCCAGG - Intronic
1132627628 16:899246-899268 GTCTGGGCCTCGGCCTCACAGGG + Intronic
1132729836 16:1355928-1355950 CGGTGGGCACAGGACTCACCAGG + Intronic
1133042689 16:3068878-3068900 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1133044732 16:3081521-3081543 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1134637529 16:15803736-15803758 CTCTGGGCCTAGGATTCACAAGG - Intronic
1135105457 16:19645619-19645641 CTGTTGGCCTCCGGCTCAGCTGG + Intronic
1139356936 16:66372124-66372146 CTGTGGTCCTCAGACCCATCAGG + Intronic
1139582909 16:67883876-67883898 CTCTGGGCCTCGGTGCCACCAGG + Intronic
1139594533 16:67950149-67950171 CCCTGGGCCTGGCACTCACCTGG - Intronic
1141347447 16:83260540-83260562 CTCTGTGCATCGGAATCACCCGG + Intronic
1141452722 16:84116639-84116661 CTCGGGGCCTCGGACGCAACCGG + Intronic
1142226679 16:88880980-88881002 CTGTGGACCTTGGACTCGGCTGG + Intronic
1142815110 17:2419297-2419319 CTGTGTGCCTCAGTCACACCGGG + Exonic
1143134455 17:4703844-4703866 ACGCGGGCCACGGACTCACCTGG + Exonic
1143456396 17:7070763-7070785 CTGTGGGACTGGGAATCTCCAGG + Intergenic
1143473767 17:7191828-7191850 CTGTGGCCCTGGGCCTCACAAGG - Intronic
1145960035 17:28881841-28881863 CGGTGGGCCTCGGCCTCGGCAGG + Exonic
1146956489 17:36939038-36939060 CCGTGGGAGTCGGAGTCACCTGG - Intronic
1147594614 17:41708853-41708875 CTGCCGGCCTCGGCCTCCCCAGG + Intergenic
1148861369 17:50606020-50606042 CTCTGAGCCTGGGGCTCACCTGG - Exonic
1151656407 17:75498320-75498342 CTCTGGGGCTGGGACCCACCTGG - Exonic
1152600188 17:81258433-81258455 CCGTGGGCCTCCGGCTCACCTGG - Intronic
1157314596 18:46577061-46577083 CTTGGGGCCTTGGACTGACCCGG - Intronic
1157805711 18:50656059-50656081 CTGGGGTCCTGGGTCTCACCTGG - Intronic
1158694945 18:59696077-59696099 ATGTGGGCCACAGATTCACCTGG - Intronic
1160179834 18:76624517-76624539 CCAGGGGCCTCGGCCTCACCTGG + Intergenic
1161465828 19:4429759-4429781 CTGTGGGACAGGGACTCCCCAGG - Exonic
1161849487 19:6731180-6731202 ACCTGGGCCTCGGGCTCACCTGG + Exonic
1162439940 19:10686677-10686699 CTGTAGGTCTAGGCCTCACCCGG + Intronic
1162464142 19:10830575-10830597 CTGGGAGCCCCGGAGTCACCAGG - Intronic
1163604451 19:18266381-18266403 CTGTGGGCCCCGGATACATCTGG + Exonic
1164531188 19:29049425-29049447 CAGTGGGCCTCACACTGACCTGG - Intergenic
1165521278 19:36316159-36316181 CTGTGTGCATCAGACTCACCTGG + Intergenic
1165622786 19:37262431-37262453 CTGTGTGCATCAGACTCACCTGG - Intergenic
1165634481 19:37329061-37329083 CTTTGTGCATCAGACTCACCTGG - Intronic
1168353599 19:55689458-55689480 CTGTGGGCTTCGGGCCCAGCAGG - Intronic
925006358 2:445740-445762 CTCTGGGCCTCTACCTCACCCGG - Intergenic
925154648 2:1639998-1640020 CTGAGGGCCCCTCACTCACCCGG - Intronic
925154663 2:1640041-1640063 CTGAGGGCCCCTCACTCACCCGG - Intronic
925154678 2:1640084-1640106 CTGAGGGCCCCTCACTCACCCGG - Intronic
925154693 2:1640127-1640149 CTGAGGGCCCCTCACTCACCCGG - Intronic
925154708 2:1640170-1640192 CTGAGGGCCCCTCACTCACCCGG - Intronic
925367108 2:3318057-3318079 CTGTGCGCCTGGGACCCAGCAGG - Intronic
929570338 2:43018902-43018924 CTGTGGCCCTGGGACTCCCTGGG + Intergenic
931877198 2:66526885-66526907 GTGTGGGCCTGAGACTCACAGGG - Intronic
933698416 2:85237372-85237394 CTGCAGACCTCGGAGTCACCAGG - Intronic
936285379 2:111177302-111177324 CAGTGTGCCTCTGACTCAGCGGG + Intergenic
937012143 2:118572289-118572311 CTGTGGGCCTCAGCCTCCCTGGG + Intergenic
937345802 2:121124583-121124605 CTGTGGGCATCAGCCTTACCTGG - Intergenic
938493079 2:131776100-131776122 CTGTGGCTCTGGGACACACCGGG - Intergenic
942748580 2:179264195-179264217 CTGCGGGCCGCGGCCGCACCCGG + Intronic
943720674 2:191200306-191200328 CTTTGGGACTAGGAATCACCGGG - Intergenic
947839368 2:233197896-233197918 CTGAGGGCCTCGTAAGCACCTGG - Intronic
1172480891 20:35270719-35270741 CTGAGGCCCTCTGACTCTCCTGG - Intronic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1172900491 20:38331087-38331109 CCAAGGGCCTCAGACTCACCGGG - Exonic
1176232390 20:64039020-64039042 CTGTGGGCCTAGGACCGCCCCGG + Intronic
1180051684 21:45334600-45334622 CTGTGGGACTCGGCCACACCAGG - Intergenic
1180884564 22:19232069-19232091 CTGTGGGTGTCTGACTGACCTGG - Intronic
1180966177 22:19789043-19789065 CTGTGGGCCTGCGTCTCTCCTGG - Intronic
1181712221 22:24697749-24697771 CTGTGGGCCTCACAGCCACCTGG - Intergenic
1182063895 22:27416931-27416953 CTGTGGGCCCCAGACACATCGGG + Intergenic
1183270721 22:36861047-36861069 CTGTGGTCCTGGGAGTCCCCAGG - Exonic
1183536049 22:38402004-38402026 CTGAGGGGCTCGGGCTCTCCGGG + Intergenic
1183733688 22:39631942-39631964 CTGTGGCCCTGGGACTCCCTGGG + Intronic
1184787606 22:46679337-46679359 CTGGGGGCTTCGGCCACACCTGG - Exonic
1185184873 22:49393040-49393062 CTGTGGCTCTAGGACTCCCCTGG - Intergenic
1185392589 22:50570712-50570734 CTGTGGTCCTGGGACTGAGCAGG - Intronic
950163905 3:10779532-10779554 CTGTGGCCCAAGGACCCACCTGG + Intergenic
951586417 3:24219747-24219769 CTGTGTGCATCAGAATCACCTGG + Intronic
952821795 3:37492311-37492333 CTGAGGGCCTGGGACACACATGG - Intronic
954376273 3:50195620-50195642 CTGGGGGCCCACGACTCACCTGG + Exonic
955468354 3:59259584-59259606 CTGTGGGCCTCTGACACCACTGG - Intergenic
956772222 3:72536347-72536369 CTGTGGGCGAACGACTCACCTGG + Intergenic
957080967 3:75635068-75635090 CTGTGGCCCTCAGATGCACCTGG - Intergenic
961457967 3:127033566-127033588 CTGGGGTCCTGGGGCTCACCAGG + Intronic
962191172 3:133312516-133312538 CTGTGGGTGTGGGACCCACCAGG + Intronic
962854280 3:139329993-139330015 CTGTGGGTCTCTGGCTCCCCTGG + Intronic
964416852 3:156456891-156456913 CAGCGTGCCTCTGACTCACCAGG - Intronic
968514112 4:1009365-1009387 CTGCGCGCCTGGGGCTCACCGGG + Intergenic
968689309 4:1982525-1982547 CTGTGGGCCTGGGGACCACCCGG - Intergenic
968876526 4:3270552-3270574 CTGAGGGCCTGGGGCTCCCCCGG - Intronic
968933889 4:3599981-3600003 CTGTGGGCCTGGGACTGCCTGGG - Intergenic
969337934 4:6522554-6522576 CTGGGGCCCCCGGAGTCACCGGG + Intronic
971311701 4:25530679-25530701 TTGTGGGCATGGGACTCAACTGG + Intergenic
977810198 4:101348037-101348059 TTGTGGGCCACGCACACACCCGG - Intronic
979275787 4:118812916-118812938 CTGTGGGGCTCCGACTCCCATGG - Intronic
980977810 4:139627838-139627860 CTGTGGGCTTGGCACGCACCTGG + Intergenic
981008386 4:139899112-139899134 CTGTTGGCCTAGGATTCCCCAGG + Intronic
985449924 4:190056068-190056090 CTGTGGCCCTCAGATGCACCTGG + Intergenic
985537625 5:473731-473753 CTGGGGGCCTGGGAGGCACCCGG - Intronic
985652515 5:1113484-1113506 CTGTAGGCCTGGGACCCTCCTGG + Intergenic
985775663 5:1840511-1840533 CTGAGGGCGTCGGGCTCGCCAGG + Intergenic
998451065 5:142235248-142235270 CTGTGGTCCTCGGAATCATGGGG + Intergenic
999927988 5:156400126-156400148 CAGTGAGCATCAGACTCACCTGG + Intronic
999947264 5:156610817-156610839 CTGTGGGCGTAGGACCCTCCAGG + Intronic
1001287763 5:170436132-170436154 CTGTGGGCCTCAGAACCCCCTGG - Intronic
1003721298 6:8705614-8705636 GTGTGGGCCTTGGACTCCCAGGG - Intergenic
1008727517 6:54440869-54440891 CCTTGGACCTCGGACCCACCTGG - Intergenic
1008763349 6:54880684-54880706 CTGTCCGCCTCGGCCTCCCCAGG + Intronic
1012973876 6:105758858-105758880 CTCTGGCCCTCATACTCACCAGG + Intergenic
1014725023 6:124962804-124962826 CTGCGGGACTGGCACTCACCGGG + Exonic
1015135651 6:129866865-129866887 CAGTGGGCATCAGAATCACCTGG + Intergenic
1017817922 6:158028425-158028447 CTGGGGGCATCAGAATCACCTGG + Intronic
1019051885 6:169189943-169189965 CTGTGAGCCTCAGAGCCACCAGG + Intergenic
1019420655 7:949233-949255 TTGTGGGCCTCTGCCTCCCCCGG + Intronic
1019429251 7:991101-991123 ACGTGGGCCTCGGGCTCCCCTGG - Intergenic
1019441430 7:1049416-1049438 CTGTGTGCCTCGGTTTCCCCAGG - Intronic
1020002261 7:4762574-4762596 CTGTGGGCATCGGCGGCACCTGG + Exonic
1023260075 7:38349763-38349785 CTGTAGGCAGCGTACTCACCAGG + Intergenic
1023260545 7:38354122-38354144 CTGTAGGCAGCGCACTCACCAGG + Intergenic
1023261057 7:38358918-38358940 CTGTAGGCAGCGTACTCACCAGG + Intergenic
1023261517 7:38363267-38363289 CTGTAGGCAGCGCACTCACCAGG + Intergenic
1023262014 7:38367994-38368016 CTGTAGGCAGCGCACTCACCAGG + Intergenic
1023845206 7:44116541-44116563 CTCTGAGCCTGGGACTCGCCTGG - Intronic
1023870838 7:44262287-44262309 CTCTTGGCCTCGGAGGCACCTGG - Intronic
1024124235 7:46275330-46275352 CTGTGGGCCACGGAACCTCCAGG + Intergenic
1029122572 7:98278712-98278734 CTGTGGCCCTGGAACTCTCCAGG + Intronic
1033418218 7:141183149-141183171 CTGAGGTCCTCTGACTCACAAGG - Intronic
1035334035 7:158114209-158114231 GAGTGGGCCAAGGACTCACCAGG + Intronic
1035637637 8:1158737-1158759 CTGTGTGACTCGGAGCCACCAGG - Intergenic
1037564757 8:20108325-20108347 GTGTGGGCCTTTGTCTCACCTGG + Intergenic
1037892982 8:22633691-22633713 GTGTGGGCCTCAGCATCACCTGG + Intronic
1045111907 8:98944513-98944535 CTGTGGGCTCCGACCTCACCGGG + Exonic
1047741501 8:127810426-127810448 CTGAGAGCCTCTGACGCACCAGG - Intergenic
1049095284 8:140544914-140544936 ATGTGGGCCTCGGGCTCTCCGGG + Intronic
1056705964 9:88953039-88953061 CTGTGGGCACCAGACCCACCAGG - Intergenic
1057367164 9:94433265-94433287 CTGTGGCCCTCGGATCCCCCTGG + Intronic
1057656170 9:96954805-96954827 CTGTGGCCCTCGGATCCCCCTGG - Intronic
1058081960 9:100710224-100710246 CTGTGGGCATGGGACCCACCGGG + Intergenic
1060110675 9:120904385-120904407 CTGTAGCTCTAGGACTCACCTGG + Exonic
1060771175 9:126333326-126333348 CTGTCCGCCTCGGACTCCCAAGG + Intronic
1062002212 9:134222049-134222071 CTGTGCAGCTCTGACTCACCGGG + Intergenic
1062426589 9:136508851-136508873 CTGTGGCCGGCGCACTCACCTGG + Exonic
1062519147 9:136950439-136950461 CTGTGGGTCTCGGGCTGGCCAGG + Intronic
1062591724 9:137277504-137277526 CAGGGGCCCTCGGCCTCACCAGG + Intergenic
1185619090 X:1442516-1442538 TAGTGGGCCGCGGACTGACCAGG + Intronic
1198318387 X:135493465-135493487 CTGGGGGCCTGGGGATCACCTGG + Intergenic
1199365972 X:146983397-146983419 CTGTGAGCCTCGGACACAAAAGG - Intergenic
1200119732 X:153784620-153784642 CTGTGAGCCTCGGGGTCCCCAGG - Intronic
1202189846 Y:22230599-22230621 CTGGTGGCCTAGGACTCCCCAGG - Intergenic