ID: 1104639260

View in Genome Browser
Species Human (GRCh38)
Location 12:130457065-130457087
Sequence CAGCCCGGGCACTTTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104639253_1104639260 11 Left 1104639253 12:130457031-130457053 CCAGCCAACCGTAGATTGTTCTG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 106
1104639256_1104639260 7 Left 1104639256 12:130457035-130457057 CCAACCGTAGATTGTTCTGGGCT 0: 1
1: 0
2: 0
3: 7
4: 43
Right 1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 106
1104639252_1104639260 12 Left 1104639252 12:130457030-130457052 CCCAGCCAACCGTAGATTGTTCT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 106
1104639257_1104639260 3 Left 1104639257 12:130457039-130457061 CCGTAGATTGTTCTGGGCTGTGC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 106
1104639251_1104639260 29 Left 1104639251 12:130457013-130457035 CCTGCAAACACTCAGCTCCCAGC 0: 1
1: 0
2: 1
3: 26
4: 303
Right 1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104639260 Original CRISPR CAGCCCGGGCACTTTGCAGT TGG Intronic
900297820 1:1960766-1960788 CATCCCGGGCTCTGTGCAGTCGG - Intronic
901020416 1:6252480-6252502 CAGCCCGGTCCCTGTGCAGATGG - Intronic
901045628 1:6393852-6393874 CGGCCCGGGCTCCTGGCAGTGGG + Intronic
901930736 1:12595206-12595228 CGGCCCGGGCACTTTGTTATTGG - Intronic
913169995 1:116223019-116223041 CAGCCTGGGCAATGTGCAGTCGG - Intergenic
913588277 1:120297781-120297803 CAGCCCAGGCACATTGCACACGG - Intergenic
913619908 1:120600588-120600610 CAGCCCAGGCACATTGCACACGG + Intergenic
914570294 1:148909654-148909676 CAGCCCAGGCACATTGCACACGG - Intronic
914602534 1:149220615-149220637 CAGCCCAGGCACATTGCACACGG + Intergenic
920173227 1:204084352-204084374 CAGCCTGGCTAATTTGCAGTTGG - Intronic
922516893 1:226214600-226214622 CAGCCTGGGAAATTTCCAGTTGG - Intergenic
922909432 1:229203387-229203409 CAGCTCATGCATTTTGCAGTTGG - Intergenic
923049607 1:230381570-230381592 TGGCCCAGGCACTTAGCAGTGGG + Intronic
1067661885 10:48242268-48242290 CAGGCGGTGCACGTTGCAGTCGG - Exonic
1076187426 10:128460389-128460411 CAGCCCAGGCACTGTCCAGAGGG + Intergenic
1076205026 10:128590725-128590747 CAGCCATGGCATTTTCCAGTAGG + Intergenic
1077014569 11:393934-393956 CAGACCGGGCCCTTTGTCGTGGG - Intronic
1077100982 11:822228-822250 CAGCCTGGGCACTGAGCAGATGG - Intronic
1083787551 11:64960957-64960979 CCCTCCGGGGACTTTGCAGTTGG - Intronic
1097583050 12:61481597-61481619 CAGCCTGGCCACTCTTCAGTAGG - Intergenic
1103222726 12:119259367-119259389 CAGCCCAGGCAGGCTGCAGTGGG + Intergenic
1103972006 12:124678425-124678447 CAGCCCAGGCACTTTCTAGCTGG - Intergenic
1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG + Intronic
1106549288 13:30757624-30757646 CATCCCTGGGACTTTGCAGGGGG - Intronic
1108071069 13:46629140-46629162 CAGCCCTGGAACTTTGCCCTTGG - Intronic
1109884435 13:68524276-68524298 CAGACCGGGCACTGCGGAGTAGG - Intergenic
1110867045 13:80407686-80407708 CAGCCTGGCCACTTTTCTGTAGG + Intergenic
1112435459 13:99388681-99388703 CAACCAGGGCACTTGGCAGTGGG + Intergenic
1112657163 13:101463303-101463325 CAGCCCTGGCACTATAGAGTAGG - Intronic
1113429559 13:110237560-110237582 CAGCCCGGGCTTTTTCCACTTGG - Intronic
1113577610 13:111405138-111405160 CAGCCCTGGCACCCTGCAGTGGG - Intergenic
1115304688 14:31922180-31922202 CAGCCGGGGCAGATTGCACTTGG - Intergenic
1116457547 14:45136313-45136335 CAGCCCGGGAAATGTGCAGCTGG - Exonic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1122307682 14:100776225-100776247 CAGCACGGACACTTTGCACAGGG - Intergenic
1122806764 14:104263737-104263759 GAGGCCGGGCACTGTACAGTTGG + Intergenic
1123467748 15:20529003-20529025 GAGCCCGGGCACTCTGCAGGAGG + Intergenic
1123650365 15:22472039-22472061 GAGCCCGGGCACTCTGCAGGAGG - Intergenic
1123728061 15:23124212-23124234 GAGCCCGGGCACTCTGCAGGAGG + Intergenic
1123740773 15:23280881-23280903 GAGCCCGGGCACTCTGCAGGAGG - Intergenic
1123746225 15:23321677-23321699 GAGCCCGGGCACTCTGCAGGAGG + Intergenic
1124278492 15:28344994-28345016 GAGCCCGGGCACTCTGCAGGAGG + Intergenic
1124304208 15:28566614-28566636 GAGCCCGGGCACTCTGCAGGAGG - Intergenic
1125739447 15:41952002-41952024 CAACCAGGGAACTTGGCAGTGGG - Intronic
1129894264 15:79091771-79091793 TGGCCCGGGCGCTTTGCAGCGGG + Intergenic
1132421680 15:101675231-101675253 CAGCCCTGGGACTCTACAGTCGG + Intronic
1137724184 16:50646046-50646068 CAGCCTGGGACCTTTGAAGTCGG + Intergenic
1138008436 16:53357689-53357711 GAGCCCGGGCACTCTGCAGGAGG + Intergenic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141982751 16:87560517-87560539 CAGCCCGGGAACTAGGCCGTGGG + Intergenic
1141996399 16:87638916-87638938 CAGCCTGGTGCCTTTGCAGTGGG + Intronic
1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG + Intronic
1148528620 17:48367094-48367116 AAGCCAGGGCACTTTAAAGTAGG - Intronic
1149967199 17:61176753-61176775 CTGCCTGGGCACTATACAGTGGG - Intronic
1153156030 18:2149820-2149842 CAACCAAGGCACTTTGCAGAAGG + Intergenic
1156126905 18:33917025-33917047 CAACCCAGGCACTATGCAGAAGG + Intronic
1157134285 18:45038795-45038817 CAGCACTGGCTCTTTGAAGTGGG + Intronic
1160699209 19:497975-497997 CAGCCTGGGCGCGGTGCAGTCGG + Exonic
1161392656 19:4029214-4029236 CAGAGGGGGCACTTGGCAGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161480235 19:4506689-4506711 CAGCCCAGGCACTCTTCAGAAGG - Intronic
1161961207 19:7524219-7524241 CAGACCTGCCACTTTACAGTAGG - Intronic
1164902701 19:31941562-31941584 CAACCAGGCCACTTTGCAGATGG + Intergenic
1167149820 19:47702117-47702139 CAGCCCGGGCGCCTCCCAGTCGG - Exonic
925128091 2:1476094-1476116 CAGCCTGGGCACTGAGGAGTAGG - Intronic
927204750 2:20600096-20600118 CAGCCCAGCCTCTGTGCAGTCGG + Intronic
935661432 2:105469877-105469899 CATCCCGGGCCCTATCCAGTGGG + Intergenic
938282202 2:130072380-130072402 GAGCCCGGCCACTTTTCTGTAGG + Intergenic
938356979 2:130659719-130659741 GAGCCCGGCCACTTTTCTGTAGG - Intergenic
938433415 2:131266525-131266547 GAGCCCGGCCACTTTTCTGTAGG - Intronic
1172689330 20:36779465-36779487 CAGCCCCAGCACTTTGCAATGGG - Exonic
1174067512 20:47875844-47875866 CAGGCCGGGAACTCTGCTGTGGG - Intergenic
1175765731 20:61591165-61591187 CAGCCCTGGTACTTATCAGTGGG - Intronic
1176144418 20:63559213-63559235 CAGTCCTGGCACCTTGCAGGTGG + Exonic
1179837815 21:44049058-44049080 CAGCCCTGGCTCCTTCCAGTGGG + Intronic
1180141158 21:45893986-45894008 AGGCCAGGGCACTTTGCAGACGG + Intronic
1183389836 22:37539222-37539244 CTGCCTGGGGATTTTGCAGTGGG + Intergenic
949533188 3:4977494-4977516 CAGCCAGGTCACTCAGCAGTGGG + Intergenic
950009957 3:9715934-9715956 CAGCCCTGGCACTTTGGAAAAGG - Intronic
950045647 3:9947252-9947274 CAGCCCGGGCCCTCGGCTGTTGG - Exonic
950187283 3:10952912-10952934 CAGCTCTGGCATTTGGCAGTAGG - Intergenic
954646523 3:52135077-52135099 CTGCCTGGGCACTCTGCAGCAGG - Intronic
957261255 3:77904868-77904890 CAGCCCATGAACCTTGCAGTGGG - Intergenic
962277543 3:134027685-134027707 TAGCCCTGCCACTTTGCAGTGGG - Intronic
962874095 3:139522634-139522656 CAGCCTGGGCACTTCTCTGTGGG - Intronic
969103972 4:4791211-4791233 CAGCCTTGGCACTGTGGAGTCGG + Intergenic
969867190 4:10083718-10083740 CTGCCCAGGCACTCTGCAGATGG + Intronic
973637075 4:52870324-52870346 CAGGCCGGGCCCTATGCAGATGG - Intergenic
975927320 4:79473086-79473108 CAGCAAGGGCACTTTCCACTGGG + Intergenic
976326744 4:83780218-83780240 CAGCCCGAGAGCTTAGCAGTTGG + Intergenic
979900710 4:126214212-126214234 CAGCCAGGGCACTCTGCCGATGG - Intergenic
984817673 4:183852984-183853006 AACCCGGGGCACTTTGGAGTGGG + Intergenic
984959362 4:185080073-185080095 CATCTCAGGGACTTTGCAGTTGG + Intergenic
993383737 5:87238811-87238833 CAGACCTGGCCCTTTGCAGGTGG - Intergenic
994346695 5:98696312-98696334 CAGTCTGGCCACTTTTCAGTAGG + Intergenic
996901928 5:128552346-128552368 CAGTCTGGCCACTTTTCAGTGGG - Intronic
998506543 5:142677012-142677034 CAGTCCAGGCTTTTTGCAGTTGG - Intronic
1002488104 5:179553343-179553365 CAGGCCGGGAATTTTGCACTGGG + Intronic
1003196542 6:3919989-3920011 CAGCCTGCCCACTTTGCAGCGGG - Intergenic
1015518328 6:134107132-134107154 AAGTCCAGGCACTTTGCAGCTGG + Intergenic
1017590697 6:155975384-155975406 CAGCACGGGCTCCTTGCACTGGG - Intergenic
1018047304 6:159977293-159977315 CTGACCGTGCACTCTGCAGTGGG + Intronic
1020005827 7:4783438-4783460 CAGCCCGGGCACCCTCCAGGAGG + Exonic
1023190107 7:37570999-37571021 CAGCCCTGCCAGTTTGCAGGAGG - Intergenic
1023631194 7:42166079-42166101 CAGGCTGGGCAGTTTGGAGTTGG - Intronic
1026880583 7:73904604-73904626 CAGCCTGGGCTCTAGGCAGTGGG + Intergenic
1029052155 7:97700492-97700514 CAGCCTGGCCACTTTTCTGTAGG - Intergenic
1029196503 7:98809298-98809320 GAGCCCAGCCACTTAGCAGTTGG - Intergenic
1029286356 7:99468636-99468658 CTGCCCGGACACAGTGCAGTCGG - Intergenic
1030347985 7:108455414-108455436 CAGCCCAGGCTCTTAGCGGTGGG - Intronic
1033242346 7:139690549-139690571 CAGCCCCAGCACTTTGGGGTGGG + Intronic
1033582566 7:142750730-142750752 CTGGCCGGGAGCTTTGCAGTCGG - Intronic
1035041993 7:155935819-155935841 CAACACTGGCACTTTGCTGTGGG - Intergenic
1035051967 7:156004147-156004169 CAGCCCCTTCACTTTGCAGATGG + Intergenic
1038150525 8:24939318-24939340 CAGCCCGGGGACTCTGAAGTGGG - Intergenic
1039417500 8:37408335-37408357 CAGCCCAGGGTCTTTGCACTTGG - Intergenic
1042619960 8:70694042-70694064 CAGTCTGGGCACTTTTCTGTAGG + Intronic
1048499646 8:134963988-134964010 CAGTCCTGGCACATTGCAGAGGG - Intergenic
1048567270 8:135614853-135614875 CTGCACTGGGACTTTGCAGTGGG + Intronic
1057509292 9:95664138-95664160 CAGCCCCGGGCCTTTGCACTTGG + Intergenic
1061889228 9:133608965-133608987 CAGCCGGGGCAGGCTGCAGTGGG + Intergenic
1187710293 X:22046392-22046414 CAGCAAGGTCACTTTGCAGAAGG + Intronic
1195049207 X:101081333-101081355 AAGCCCAGGCACTATGCAGTAGG - Intronic