ID: 1104639697

View in Genome Browser
Species Human (GRCh38)
Location 12:130459584-130459606
Sequence GCCGCCCTTAGCCCCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104639697_1104639701 2 Left 1104639697 12:130459584-130459606 CCATCAAGGGGGCTAAGGGCGGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1104639701 12:130459609-130459631 AGGTCACAGGAGCCTAAAGCGGG 0: 1
1: 0
2: 3
3: 10
4: 201
1104639697_1104639700 1 Left 1104639697 12:130459584-130459606 CCATCAAGGGGGCTAAGGGCGGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1104639700 12:130459608-130459630 GAGGTCACAGGAGCCTAAAGCGG 0: 1
1: 0
2: 0
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104639697 Original CRISPR GCCGCCCTTAGCCCCCTTGA TGG (reversed) Intronic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
1065881656 10:30042492-30042514 TCCGCCCTTGCTCCCCTTGATGG - Intronic
1070728789 10:78810636-78810658 GCAGCCCCTAGCCACCTTCATGG - Intergenic
1076516086 10:131045176-131045198 GCAACCCTCAGCCCCCATGATGG + Intergenic
1077135681 11:997087-997109 GCCACCCTGAGGCCCCTTCACGG - Intronic
1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG + Exonic
1089554508 11:119308872-119308894 GGCTCCCATAGCCCTCTTGATGG - Exonic
1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG + Intronic
1092083094 12:5734466-5734488 GCCTCCCTTAGCCCCTGTGCAGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104944686 12:132410359-132410381 GCCCCCCTCACCCTCCTTGATGG + Intergenic
1105538823 13:21297125-21297147 TCCTCCCTTAGCCCCTTTGGAGG - Intergenic
1108051603 13:46447170-46447192 ACCTCCTTTAGTCCCCTTGATGG - Intergenic
1117733982 14:58751152-58751174 GCCGCCCTTAGCCCCCACTCAGG - Intergenic
1118753337 14:68821744-68821766 GCCCACCTTGGCCCACTTGATGG + Intergenic
1122133695 14:99620550-99620572 TCTGCCCTTAGCCCCCCTGCGGG - Intergenic
1123434518 15:20245309-20245331 GCCCCCTTTATCCCCCTTAAGGG + Intergenic
1126197893 15:45952232-45952254 GCAGCACTTAGCCCCCTAAAGGG - Intergenic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG + Intergenic
1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG + Intronic
1136105008 16:28024176-28024198 GTTGCCCTCAGCCCCATTGAAGG - Intronic
1136850104 16:33605794-33605816 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1141660842 16:85440721-85440743 GCCGCGCTGTGCCCCCGTGATGG - Intergenic
1203111717 16_KI270728v1_random:1454247-1454269 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1144092975 17:11874324-11874346 GCCTCTCTTAGGCCCCTTCAGGG - Intronic
1144132456 17:12259966-12259988 GCCCCCCTTAGACCCCTGAAGGG - Intergenic
1146150624 17:30466665-30466687 GCCACTCTTAGGCCCCTTGTTGG - Exonic
1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG + Intronic
1150774700 17:68070117-68070139 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1151084510 17:71365106-71365128 CCTGCCCTTAGCCCCCCTGATGG + Intergenic
1157383809 18:47246648-47246670 GCCGCCCCTGGCCCCCCAGAAGG - Intronic
1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG + Intergenic
926133251 2:10318721-10318743 GCTGCCCTTAGCCTCCCAGATGG - Intronic
934079776 2:88458086-88458108 GCAGCCCTTTCCCCCCATGAAGG + Intergenic
942564563 2:177253462-177253484 GCAGCACGTATCCCCCTTGAGGG - Intronic
1170420490 20:16187565-16187587 GTCTCCCTTAGTCCCCATGATGG - Intergenic
1174403130 20:50286703-50286725 GCAGCCCTCAGCCCCCTGGCTGG - Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1183304464 22:37075049-37075071 GCTGCCCACAGCCCCCTTGGTGG + Intronic
950104256 3:10378349-10378371 GCCGCCCTCGGCACTCTTGAGGG + Exonic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
992810852 5:80387024-80387046 GACTCCCTTTGCCCCCTTGGTGG + Intergenic
1001770746 5:174294075-174294097 GCCTCCCTTTTCCACCTTGAAGG - Intergenic
1001970965 5:175954595-175954617 GCCTCCCTTTGCCCCATTGCTGG - Intronic
1001973820 5:175979795-175979817 GCCGCACTCAGCCCTCTTGTGGG - Intronic
1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG + Intergenic
1002246477 5:177889182-177889204 GCCTCCCTTTGCCCCATTGCTGG + Intergenic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1032328744 7:130957321-130957343 GCCACCCTGAGCCCTCTTGCTGG - Intergenic
1034123744 7:148652286-148652308 GCCCTCCATAGCCCCCTTAAGGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1057201092 9:93140364-93140386 CCCACCCTCAGCCCCCTCGATGG + Intergenic
1185943957 X:4353641-4353663 TCAGCCCTCAACCCCCTTGAGGG - Intergenic
1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG + Intronic
1190688712 X:52896394-52896416 GCCCCCTTTATCCCCCTTAAGGG - Intronic
1190697271 X:52959398-52959420 GCCCCCTTTATCCCCCTTAAGGG + Intronic
1193040746 X:77001186-77001208 TCTGCCCTTAGCTCCCATGAAGG - Intergenic
1195370243 X:104166412-104166434 GCCGCCCTTCCCCTCCTTGCGGG + Intergenic