ID: 1104640915

View in Genome Browser
Species Human (GRCh38)
Location 12:130466437-130466459
Sequence CCATTGCCACCAAAACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 414}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104640910_1104640915 20 Left 1104640910 12:130466394-130466416 CCTCAGGACTTCACGCAGAGCAA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1104640915 12:130466437-130466459 CCATTGCCACCAAAACCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 414
1104640909_1104640915 27 Left 1104640909 12:130466387-130466409 CCTGGGACCTCAGGACTTCACGC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1104640915 12:130466437-130466459 CCATTGCCACCAAAACCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 414
1104640911_1104640915 -3 Left 1104640911 12:130466417-130466439 CCAAGAAAAAAGACACTTCCCCA 0: 1
1: 0
2: 1
3: 35
4: 353
Right 1104640915 12:130466437-130466459 CCATTGCCACCAAAACCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104640915 Original CRISPR CCATTGCCACCAAAACCTCC TGG Intronic
900327275 1:2114697-2114719 CCACTGCCACCTCCACCTCCCGG - Intronic
900697955 1:4023993-4024015 CCACAGCCACCAGAAACTCCAGG - Intergenic
901442337 1:9286059-9286081 CCATTGCCAGGAGAACTTCCAGG + Intergenic
901819237 1:11815881-11815903 CCATGGTCTCCAAAACTTCCAGG - Exonic
903322223 1:22550102-22550124 CCATGGCAACCAATCCCTCCTGG - Intergenic
903542999 1:24107367-24107389 CCCTTGCCTCCAAAACAGCCTGG + Intronic
904258827 1:29275321-29275343 CCATTGCCCCCAAGAGCTCAGGG - Intronic
904341518 1:29837848-29837870 CCAATGCCAACAAAAGCTCGAGG - Intergenic
905063301 1:35158159-35158181 TCACTGCAACCACAACCTCCCGG - Intergenic
905127822 1:35728156-35728178 TCATTGCAGCCACAACCTCCAGG + Intronic
905679360 1:39856407-39856429 TCATTGCCACCTTGACCTCCTGG - Intronic
905989782 1:42326174-42326196 TCATTGCAACCTCAACCTCCTGG - Intronic
905990190 1:42330561-42330583 TCATTGCAACCTCAACCTCCTGG - Intronic
906429405 1:45743010-45743032 CCACTACAACCAACACCTCCTGG + Intronic
906876740 1:49547383-49547405 CCATAGTCACCAAAACATCCTGG - Intronic
907035066 1:51208906-51208928 CCACTGCCACCTCCACCTCCTGG - Intergenic
908134347 1:61115052-61115074 CCACTGCAACCTACACCTCCCGG + Intronic
908614126 1:65898576-65898598 CCATAGTCACCAAAACATCATGG + Intronic
909281238 1:73756259-73756281 CCAAAGCCACCCCAACCTCCAGG - Intergenic
909298503 1:73982220-73982242 CCATAGTCACCAAAACATCATGG - Intergenic
909731635 1:78899427-78899449 CCACTGCAACCTCAACCTCCTGG + Intronic
911455631 1:98119409-98119431 GCACTGCCACCAAAACCAGCTGG + Intergenic
912169690 1:107083639-107083661 CAATTTCCATCAAAACCTCAAGG - Intergenic
912951092 1:114121056-114121078 CCATAGCCACCAAGGCCCCCAGG + Intronic
916040758 1:160959330-160959352 TCACTGCCACCTAAACCTTCTGG - Intergenic
916292769 1:163184795-163184817 CAATTTCCCCCAGAACCTCCAGG + Intronic
917109430 1:171530316-171530338 TCATTGCAGCCTAAACCTCCTGG + Intronic
917566731 1:176220219-176220241 TCACTGCAACCTAAACCTCCTGG + Intergenic
917855601 1:179096748-179096770 CCATTGCACCCACCACCTCCTGG - Intronic
918735986 1:188064406-188064428 TCATTGCAACCAGCACCTCCCGG + Intergenic
918742651 1:188154557-188154579 CCATTGCAAGCAAAACTTGCAGG - Intergenic
919398030 1:197074719-197074741 CCATAGGCACCAAAACATCATGG + Intergenic
919680798 1:200432493-200432515 TCATTGCAACCACCACCTCCTGG - Intergenic
920414497 1:205789709-205789731 CCATTTCTACCCAGACCTCCAGG - Exonic
922211757 1:223491781-223491803 TCATTGCCACCTCTACCTCCTGG + Intergenic
922280767 1:224121848-224121870 CCATTGCCACCTCTGCCTCCTGG + Intronic
922506165 1:226127063-226127085 CCATTGCAACCTCCACCTCCTGG - Intergenic
922940186 1:229456900-229456922 TCACTGCCACCTCAACCTCCTGG + Intronic
924114692 1:240733589-240733611 CCATTGCAACCTCCACCTCCTGG - Intergenic
924517237 1:244776394-244776416 TCACTGCCACCTCAACCTCCTGG - Intergenic
1064121358 10:12622725-12622747 CTGATGCCACCAAAGCCTCCCGG - Intronic
1066201127 10:33143560-33143582 CCCATGCCACCAAACCCTCCCGG - Intergenic
1066706440 10:38184235-38184257 CCATTGTCACCAAAACAGCATGG - Intergenic
1066983511 10:42441818-42441840 CCATTGTCACCAAAACAGCATGG + Intergenic
1067410342 10:46058976-46058998 CAATTTCCACAAAAACCTGCTGG - Intergenic
1067471177 10:46539683-46539705 TCATTGCAACCACCACCTCCTGG + Intergenic
1069631525 10:69900002-69900024 CCAGTGCCACCCAAGCCTGCAGG + Intronic
1069822893 10:71238545-71238567 TCATTGCCACCTCCACCTCCTGG + Intronic
1069886104 10:71624623-71624645 CCATTGCAGCCTCAACCTCCTGG - Intronic
1070038841 10:72754753-72754775 TCACTGCCACCTCAACCTCCTGG - Intronic
1070077601 10:73153166-73153188 CCTTGGCCTCCCAAACCTCCTGG + Intronic
1070126112 10:73623309-73623331 TCACTGCCACCTCAACCTCCTGG - Intronic
1070942735 10:80360832-80360854 GCATTGCAGCCACAACCTCCTGG + Intronic
1071384354 10:85104550-85104572 CCATGGCCAGCATCACCTCCTGG + Intergenic
1071548056 10:86543586-86543608 CCATTGCAACCTCCACCTCCCGG - Intergenic
1072885713 10:99271756-99271778 CCATAGCCACCAAAACTGCATGG + Intergenic
1073407975 10:103314878-103314900 TCATTGCAACCAACACCTCCTGG - Intronic
1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG + Intronic
1074356960 10:112794475-112794497 TCATTGCAACCTCAACCTCCTGG - Intronic
1075749150 10:124750914-124750936 TCATTGCAACCTCAACCTCCTGG - Intronic
1075944664 10:126422054-126422076 CTATTGCCAACCAAACTTCCTGG - Intergenic
1076259445 10:129054184-129054206 CCACTCCCTCCAAAGCCTCCTGG + Intergenic
1077542303 11:3152688-3152710 CCGGTGCCTGCAAAACCTCCAGG + Intronic
1078614116 11:12848873-12848895 TCAGTGCCACCTAGACCTCCTGG - Intronic
1079309607 11:19353165-19353187 TCATTGGCACCAGATCCTCCTGG + Intronic
1079423629 11:20318338-20318360 TCATTGCAACCTCAACCTCCTGG - Intergenic
1079519200 11:21304800-21304822 CCAGTGCCACCAAAATTTCCAGG + Intronic
1080233390 11:30042945-30042967 CCATCACCACCAAAAGCTCTTGG + Intergenic
1080351472 11:31390319-31390341 TCATTGCCACCTCCACCTCCCGG - Intronic
1080463445 11:32475541-32475563 CCATTGCCATGCTAACCTCCAGG - Intergenic
1080522339 11:33078155-33078177 TCATTGCAACCACCACCTCCAGG - Intronic
1080528500 11:33150779-33150801 TCACTGCAACCAACACCTCCTGG - Intronic
1080598243 11:33795937-33795959 TCACTGCAACCACAACCTCCTGG + Intergenic
1081571290 11:44293022-44293044 CCACTGCAGCCACAACCTCCTGG - Intronic
1082033518 11:47625011-47625033 CCATTGCAACAGACACCTCCTGG - Intronic
1083137726 11:60694701-60694723 CCATTGCAACCTCAAACTCCTGG - Intergenic
1083403597 11:62441574-62441596 TCACTGCAACCTAAACCTCCTGG + Intronic
1083535813 11:63465713-63465735 TCATTGCAGCCACAACCTCCTGG - Intronic
1083971006 11:66075313-66075335 TCATTGCAACCTAGACCTCCTGG + Intronic
1084062349 11:66684558-66684580 CCATTGCAACCTCCACCTCCTGG - Intergenic
1085497207 11:76980600-76980622 TCATTGCAACCTCAACCTCCTGG - Intronic
1086249614 11:84797746-84797768 CCATAAACATCAAAACCTCCAGG - Intronic
1086326165 11:85702262-85702284 TCATTGCAACCACCACCTCCTGG + Intronic
1089824737 11:121264981-121265003 CCATTGCCATGACAACATCCAGG + Intergenic
1089896917 11:121939976-121939998 TCACTGCAACCAACACCTCCGGG + Intergenic
1090097068 11:123752724-123752746 GGATTGTCACCAAAACCCCCAGG - Intergenic
1090226246 11:125073845-125073867 CGCTTCCCACCAAAACCTACAGG + Intronic
1090866456 11:130704975-130704997 TCATTGCAACCTTAACCTCCTGG - Intronic
1091246069 11:134096049-134096071 CCATTGCAACCTCCACCTCCTGG + Intronic
1093211607 12:16315273-16315295 CCATTGCCACAGAATCCTGCAGG - Intergenic
1094145592 12:27225406-27225428 CCATTCCCACCAAAAAGGCCGGG - Intergenic
1096338377 12:50775434-50775456 CCACTGCAACCTCAACCTCCTGG + Intronic
1096730953 12:53612048-53612070 TCATTGCCACCTCCACCTCCTGG + Intronic
1096732767 12:53627532-53627554 TCACTGCCACCTCAACCTCCTGG - Intergenic
1097536973 12:60884554-60884576 CCATAGACACCAAAACATCATGG - Intergenic
1099277947 12:80602054-80602076 ACATTGCCAAGAAAACATCCAGG - Intronic
1100999905 12:100347006-100347028 TCATTGCAACCACCACCTCCTGG + Intergenic
1102114722 12:110394099-110394121 TCATTGCAACCACCACCTCCCGG - Intronic
1103671520 12:122620092-122620114 TCACTGCAACCAACACCTCCCGG - Intronic
1103805008 12:123565518-123565540 CCATTGCAACCTCCACCTCCTGG + Intergenic
1104640915 12:130466437-130466459 CCATTGCCACCAAAACCTCCTGG + Intronic
1105740619 13:23319221-23319243 TCACTGCAACCACAACCTCCTGG - Intronic
1106808422 13:33334953-33334975 CCAGTGACACCCAAACCTCACGG - Intronic
1108186504 13:47893243-47893265 CCCTTGCCACCAGTACCTCAAGG + Intergenic
1108263763 13:48683991-48684013 TCATTGCCACCTCAAACTCCTGG + Intronic
1108359319 13:49654575-49654597 TCACTGCCACCTCAACCTCCTGG - Intergenic
1111454532 13:88463217-88463239 TCACTGCCACCTCAACCTCCTGG + Intergenic
1112403557 13:99097509-99097531 TCATTGCAACCTTAACCTCCTGG - Intergenic
1113239875 13:108325614-108325636 CCATTGCCTCCATAGTCTCCAGG + Intergenic
1113566782 13:111324104-111324126 CGATTGCCACCAGCACCCCCAGG - Intronic
1113791711 13:113032641-113032663 TCACTGCCACCTCAACCTCCTGG + Intronic
1115215404 14:31008962-31008984 TCATTGCAACCTAAACCTCCTGG - Intronic
1115648813 14:35388623-35388645 GCATTACCACTAAAATCTCCAGG - Intergenic
1117183201 14:53213675-53213697 CCATATGAACCAAAACCTCCAGG + Intergenic
1117372861 14:55094531-55094553 CCACTGCCACCTCGACCTCCTGG + Intergenic
1117725343 14:58667773-58667795 CCATTCCCACCACACCCACCTGG - Intergenic
1118272473 14:64356317-64356339 CCATTGCAACCTCCACCTCCTGG + Intergenic
1118460998 14:65987039-65987061 ACATTCCCTCCAAAACCTCTAGG + Intronic
1118909759 14:70051365-70051387 TCATTGCAACCTCAACCTCCTGG + Intronic
1119672420 14:76529771-76529793 TCATTGCAACCTACACCTCCCGG + Intergenic
1119943399 14:78665768-78665790 CCATGGCCACCATCGCCTCCTGG - Intronic
1121216714 14:92254184-92254206 CCATTGCAACCTCCACCTCCCGG + Intergenic
1121307798 14:92917835-92917857 CCATTGCCACCACCAGCCCCTGG - Intergenic
1121651248 14:95560538-95560560 CCATTGCAACCTCCACCTCCTGG - Intergenic
1121769614 14:96521874-96521896 CCACTGCAACCACCACCTCCCGG + Intronic
1122340544 14:101025428-101025450 CCAATGCCACTACCACCTCCAGG - Intergenic
1122519691 14:102334571-102334593 CCAATTCCACCAGATCCTCCCGG - Exonic
1124275086 15:28320187-28320209 CCATTGCAACCTCCACCTCCCGG + Intronic
1124307613 15:28591412-28591434 CCATTGCAACCTCCACCTCCCGG - Intergenic
1124337647 15:28869246-28869268 CCATTGTCACCACAACAGCCTGG - Intergenic
1124719589 15:32099836-32099858 CTTTTCCCACCAAAAACTCCTGG + Intronic
1125353459 15:38791577-38791599 CCATTGCAACCAAAAGCCACTGG - Intergenic
1126184290 15:45815922-45815944 CCATAGCCACCAAAACAGCATGG - Intergenic
1126443002 15:48711967-48711989 TCATTGCAACCTCAACCTCCTGG + Intergenic
1126726050 15:51633706-51633728 TCACTGCAACCACAACCTCCAGG + Intergenic
1127031349 15:54867114-54867136 TCATTGCAGCCTAAACCTCCTGG - Intergenic
1127450391 15:59110803-59110825 CCATTTTCTCCAAAACCTGCAGG - Intronic
1127582097 15:60347854-60347876 CCATTGCCAGGGAAGCCTCCAGG + Intronic
1127927087 15:63557335-63557357 CCATTGCAACCTCAGCCTCCTGG + Intronic
1128370699 15:67036985-67037007 TCATTGCAACCTCAACCTCCTGG - Intergenic
1129700306 15:77763844-77763866 CCATTGCCAGCAAAAACACAGGG + Intronic
1131104376 15:89721697-89721719 ACATTGCCACCTCAAACTCCTGG + Intronic
1131235481 15:90693132-90693154 TCATTGCAACCTCAACCTCCCGG + Intergenic
1132090597 15:98945336-98945358 CCATTGCTACCATCCCCTCCTGG + Intronic
1133338605 16:5022399-5022421 ACAGTGCCACCCAAACCACCTGG + Intergenic
1133645522 16:7760784-7760806 CCACTGCCACCTATGCCTCCAGG - Intergenic
1133702876 16:8325720-8325742 CCACTGCAACCTCAACCTCCTGG + Intergenic
1133886389 16:9831991-9832013 TCACTGCAACCTAAACCTCCTGG + Intronic
1135061334 16:19273539-19273561 CCATTGCAACCTCCACCTCCCGG - Intergenic
1135264052 16:21006757-21006779 TCATTGCAACCTCAACCTCCTGG + Intronic
1135696629 16:24593507-24593529 TCATTGCCACTACCACCTCCCGG + Intergenic
1135740996 16:24975076-24975098 CCATTGCAACATTAACCTCCTGG - Intronic
1136362436 16:29789740-29789762 TCATTGCAACCTACACCTCCCGG + Intergenic
1136673638 16:31879622-31879644 CCATTGCCCCGAAAATCTGCAGG + Intronic
1138392237 16:56678273-56678295 TCATTGCAACCACAACTTCCCGG - Intronic
1138543535 16:57702956-57702978 CCACTGCAACCTCAACCTCCTGG + Intronic
1139556376 16:67713478-67713500 CCAATGCCATCAAAAGCCCCAGG + Intronic
1140131498 16:72165963-72165985 CCATTGCCACCCACAACTCTGGG - Intronic
1140167803 16:72572180-72572202 TCACTGCCACCACCACCTCCTGG - Intergenic
1140930059 16:79619010-79619032 CCAGAGCCACCAAAACCACTTGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141502435 16:84453243-84453265 CCACTGCCAGCCAAGCCTCCGGG - Intronic
1141807717 16:86353045-86353067 TCATTGCAACCACCACCTCCCGG + Intergenic
1142338121 16:89503455-89503477 CCACTTCAACCAACACCTCCTGG + Intronic
1143142911 17:4752666-4752688 TCACTGCCACCCCAACCTCCCGG + Intergenic
1144024879 17:11269114-11269136 CCATTGCAACCTCCACCTCCTGG + Intronic
1144756146 17:17681718-17681740 CCATGGCCACCCAGGCCTCCGGG + Exonic
1145188601 17:20818556-20818578 TCACTGCAGCCAAAACCTCCTGG - Intergenic
1145219568 17:21077013-21077035 TCACTGCCACCTCAACCTCCTGG - Intergenic
1145762986 17:27437737-27437759 TCATTGCCGCCTCAACCTCCTGG - Intergenic
1146452367 17:32984911-32984933 CCATTTACACCAAAATCTCTGGG - Intronic
1146661548 17:34668160-34668182 CCATTCCCACCAAGGCCTCTGGG - Intergenic
1147356290 17:39900518-39900540 TCATTGCAACCTACACCTCCCGG + Intergenic
1147967776 17:44202777-44202799 CCATGGCCAGAAAATCCTCCTGG + Intergenic
1148516591 17:48224203-48224225 ACATATCCACCAAAAGCTCCAGG - Intronic
1148601923 17:48900750-48900772 CCACTGCAACCACCACCTCCTGG - Intergenic
1148928500 17:51108569-51108591 TCATTGCAACCTCAACCTCCTGG + Intronic
1149498538 17:57134408-57134430 CCATGGCCACCAGAGCCTCCTGG + Intergenic
1149931178 17:60757086-60757108 TCATTGCAACCACCACCTCCTGG - Intronic
1150078285 17:62213142-62213164 TCACTGCAGCCAAAACCTCCTGG + Intergenic
1151386709 17:73759495-73759517 CCACTTCCACCAACCCCTCCGGG - Intergenic
1151420212 17:73991990-73992012 CCATTGCAGCCTCAACCTCCTGG - Intergenic
1151489624 17:74425048-74425070 CCACTGCCACCAAAGACTTCAGG - Intronic
1151810799 17:76440400-76440422 CCATTGCCACCTCGACCGCCAGG + Intronic
1151874687 17:76860719-76860741 CCCTTGCCACAAAAACCCTCTGG + Intergenic
1152256983 17:79245700-79245722 CCATTGCAACCTCCACCTCCTGG + Intronic
1152359126 17:79822373-79822395 TCATTGCAACCACCACCTCCCGG + Intergenic
1152412449 17:80134747-80134769 TCATTGCAGCCACAACCTCCTGG - Intergenic
1153232943 18:2957680-2957702 AAATGGCCACCAATACCTCCAGG - Intronic
1153331938 18:3882450-3882472 TCATTGCAACCTCAACCTCCTGG - Intronic
1154007579 18:10545671-10545693 ACATTTCCCCCAAACCCTCCAGG - Intronic
1155210660 18:23598032-23598054 CCATTGCAGCCTCAACCTCCTGG + Intergenic
1156358076 18:36360166-36360188 CCAAAGCCACCATATCCTCCAGG - Intronic
1157626112 18:49052620-49052642 CCATGGCCAACAAACCCTCTTGG + Intronic
1157793851 18:50557823-50557845 CCCTTGCCCCCATATCCTCCAGG + Intergenic
1157887771 18:51385067-51385089 CTATTCCCACCTAAAGCTCCAGG - Intergenic
1160429522 18:78801802-78801824 CCATGCCCACCAAATGCTCCAGG - Intergenic
1160956500 19:1694928-1694950 TCACTGCCACCTCAACCTCCTGG - Intergenic
1161687056 19:5708098-5708120 CCAATGCCACCAACAGCTTCCGG + Intronic
1163018986 19:14472811-14472833 CCAGCGCCACCAACACCTGCGGG + Exonic
1163661115 19:18578190-18578212 CCACTGCAACCTCAACCTCCCGG + Intronic
1163735119 19:18975141-18975163 TCATTGCAACCTCAACCTCCTGG - Intergenic
1164136865 19:22424233-22424255 TCACTGCCACCTCAACCTCCTGG + Intronic
1165021315 19:32926634-32926656 TCACTGCAACCTAAACCTCCCGG + Intronic
1165028270 19:32977842-32977864 CCATTGCAACCTCCACCTCCTGG - Exonic
1165203703 19:34165984-34166006 TCATTGCAACCTACACCTCCTGG - Intergenic
1165690498 19:37859269-37859291 TCACTGCCACCTCAACCTCCTGG - Intergenic
1166187699 19:41152325-41152347 CCACTGCCACCTCCACCTCCCGG - Intergenic
1166786931 19:45373223-45373245 TCATTGCCACCTTGACCTCCAGG + Intergenic
1167071430 19:47224218-47224240 CCATTGCAACCTTCACCTCCCGG - Intronic
1168192165 19:54746905-54746927 TCACTGCCACCACAGCCTCCTGG - Intronic
1168194441 19:54763461-54763483 TCACTGCCACCACAGCCTCCTGG - Intronic
925250687 2:2434629-2434651 CATTTGCCACCAAAAGCTGCAGG - Intergenic
926127143 2:10278592-10278614 CCATTCCCACCACAAACTGCTGG - Intergenic
927547959 2:23971561-23971583 CCACTGCAACCTCAACCTCCTGG + Intronic
927913862 2:26921822-26921844 CCATTGCCACCTGACCCTCTGGG + Intronic
930900443 2:56500519-56500541 CCATTGCAGCCTTAACCTCCTGG + Intergenic
931835020 2:66090018-66090040 CCATAGCCACCAAAACAGCTTGG + Intergenic
934526834 2:95057270-95057292 CCATAGCCTCCAAAATGTCCTGG - Intergenic
935610007 2:105012776-105012798 CCATAGTCACCAAAACATCATGG - Intergenic
935827315 2:106964423-106964445 TCATTGCAACCTCAACCTCCTGG - Intergenic
936518594 2:113198005-113198027 CCATTCCCACCAGGACCCCCTGG - Intronic
936835850 2:116708426-116708448 TCACTGCAACCAACACCTCCTGG - Intergenic
936847405 2:116853897-116853919 CCACTGTCACCAAAACCCTCTGG + Intergenic
937326343 2:120991667-120991689 ACTTTACCACCAAAAACTCCAGG + Exonic
937573127 2:123388285-123388307 CCATAGTCACCAAAACATCATGG + Intergenic
938108734 2:128550478-128550500 CCTCTGACTCCAAAACCTCCAGG - Intergenic
939323574 2:140656168-140656190 GCATTGTCACCAAAAGCTCAGGG + Intronic
940291276 2:152079709-152079731 CCATTGCGGCCTTAACCTCCTGG - Intronic
940956554 2:159734905-159734927 TCATTGCAACCTCAACCTCCTGG - Intronic
942187683 2:173439957-173439979 TCATTGCAACCTCAACCTCCTGG + Intergenic
944072819 2:195692225-195692247 CCATAGCCACCAAAACAGCATGG - Intronic
944441577 2:199748921-199748943 CCATTGCCTCCCAAACCCTCTGG + Intergenic
947080962 2:226396275-226396297 CCAGTGCCATCAACACCTTCTGG - Intergenic
948168679 2:235882885-235882907 TCACTGCCACCTCAACCTCCTGG + Intronic
1172256149 20:33519393-33519415 TCATTGCAACCACCACCTCCCGG - Intronic
1174288221 20:49487185-49487207 TCATTGCAACCTAAAACTCCTGG + Intergenic
1174742795 20:53032332-53032354 CCATAGCCCCCATAACCTTCAGG + Intronic
1175318451 20:58068762-58068784 CCTTTGCCTCCCAAAGCTCCTGG - Intergenic
1175571024 20:60022178-60022200 GAATTTTCACCAAAACCTCCTGG - Intronic
1175884212 20:62279738-62279760 TCATTGCCACCGCAACCTCACGG - Intronic
1177716709 21:24848035-24848057 CCATAGTCACCAAAACATCATGG - Intergenic
1178748693 21:35279731-35279753 TCATTGCAACCACCACCTCCCGG - Intronic
1179793582 21:43769500-43769522 ACATGGCCAGCAAAACCTGCAGG + Intergenic
1180018978 21:45107984-45108006 TCATTGCAACCTTAACCTCCTGG - Intronic
1180192254 21:46171117-46171139 CCATGCCCACCAACACCTCCTGG + Intronic
1181616345 22:24057307-24057329 CCACTGGCACCATAAACTCCAGG - Intronic
1182199155 22:28552489-28552511 CCATAGTCACCAAAACAGCCTGG + Intronic
1182236764 22:28882960-28882982 CCATTCCCACCCCCACCTCCAGG - Intergenic
1182734997 22:32526929-32526951 CTCTTGCAATCAAAACCTCCTGG - Intronic
1183698432 22:39436529-39436551 TCAGTGCCAACTAAACCTCCTGG + Intronic
1183905291 22:41035813-41035835 CCATTGCAACCTCCACCTCCTGG - Intergenic
1184132386 22:42524678-42524700 CCACTGCCACCTCCACCTCCCGG - Intergenic
1184225574 22:43127413-43127435 CCATTTCCACCAAAGCCCACAGG + Intronic
1185310147 22:50149835-50149857 CCATGGCCCCCAACACCTCGGGG - Intronic
949819775 3:8103558-8103580 TAATTCCCACCAAAACCACCTGG - Intergenic
950275206 3:11655121-11655143 CCATGGCTTTCAAAACCTCCTGG - Intronic
952116273 3:30185372-30185394 ACATAGCCACCAAAAGCTTCAGG + Intergenic
952329024 3:32346893-32346915 TCATTGCAACCTCAACCTCCTGG + Intronic
952689479 3:36187795-36187817 CCATTGTCACCAAAACAGCGTGG - Intergenic
952755847 3:36865852-36865874 TCATTGCCGCCTCAACCTCCTGG - Intronic
954180942 3:48880897-48880919 CCATTGCCTCCAAACCGTGCTGG - Intronic
954223828 3:49170471-49170493 CCATTGGGACCAAATCCTGCTGG - Intergenic
954629850 3:52041924-52041946 CCCTAGCCACCAAGACCTCCAGG + Intergenic
956377775 3:68634208-68634230 GCATCACCACCAAAATCTCCAGG - Intergenic
958172391 3:89954377-89954399 TCACTGCAACCAAAACCTCCTGG - Intergenic
958942797 3:100334102-100334124 CCATTGCAGCCTCAACCTCCCGG - Intergenic
959131915 3:102366632-102366654 CCATAGTCACCAAAACAGCCTGG - Intronic
959288977 3:104448892-104448914 CCATTGCCAGTCAAACCTCCTGG + Intergenic
959533930 3:107464724-107464746 TCATTGCAACCTCAACCTCCTGG + Intergenic
960210232 3:114955881-114955903 CCATTTTCACTAAAACCTCCTGG - Intronic
961786915 3:129352879-129352901 CCTTTGCCACTGAAGCCTCCCGG + Intergenic
961840106 3:129702939-129702961 CCACTGCAACCTCAACCTCCCGG - Intronic
963300701 3:143593995-143594017 CCATTGCCACCAACACAGACTGG - Intronic
963894692 3:150672948-150672970 CCACTGCAACCTCAACCTCCTGG - Intronic
963962195 3:151322258-151322280 CCACTGCAACCTCAACCTCCTGG + Intronic
964165524 3:153700450-153700472 CCATTACCACCCAGATCTCCAGG - Intergenic
964169565 3:153753817-153753839 CCATTGCCAAGAACAGCTCCTGG - Intergenic
964295737 3:155231094-155231116 GCATTACCACCAGCACCTCCAGG - Intergenic
965986884 3:174764533-174764555 TCATTGCAACCTACACCTCCTGG - Intronic
966944173 3:184766065-184766087 CCACTACCACGAAAACCTTCAGG - Intergenic
966956660 3:184887588-184887610 CCTTTGCCACCAAAAGCTGTGGG - Intronic
968145940 3:196299157-196299179 TCACTGCAACCACAACCTCCCGG + Intronic
971462145 4:26911160-26911182 TCATTGCAACCTACACCTCCTGG - Intronic
972826038 4:42760235-42760257 CCACTGCAACCTCAACCTCCTGG - Intergenic
972955862 4:44390523-44390545 CCATAGTCACCAAAACAGCCTGG - Intronic
974041087 4:56858406-56858428 TCATTGCAGCCACAACCTCCTGG - Intergenic
976649769 4:87422273-87422295 TCATTGCCGCCTCAACCTCCTGG - Intergenic
976739908 4:88346980-88347002 CGATTGCCTCGGAAACCTCCTGG - Intergenic
978278314 4:106978518-106978540 CCAGTGCAAACAAAGCCTCCAGG - Intronic
978658131 4:111091046-111091068 CCATTGCAACCTCTACCTCCCGG - Intergenic
979695375 4:123607261-123607283 CCCTGGCCAGCAAAACCTCTGGG - Intergenic
979754086 4:124317872-124317894 CCATTGCAACCTCCACCTCCTGG - Intergenic
979759754 4:124388016-124388038 TCATTGCAACCTTAACCTCCTGG + Intergenic
981556019 4:145995373-145995395 CCACTGCCACCTAGAACTCCTGG + Intergenic
981564364 4:146082802-146082824 CCATTGGCAGCAAAAGCTCTAGG + Intergenic
982700350 4:158654495-158654517 CCACTGCAACCTACACCTCCTGG + Intergenic
983109253 4:163727745-163727767 TCATTGCAACCTCAACCTCCTGG + Intronic
984004391 4:174291863-174291885 TCATTGCAACCTCAACCTCCTGG + Intronic
986259388 5:6130552-6130574 CCATAGTCACCAAAACCACATGG + Intergenic
986787221 5:11125469-11125491 CCATTCCCAGCAGCACCTCCCGG - Intronic
987247389 5:16062213-16062235 CCATTGCAACCTCCACCTCCGGG - Intergenic
987536624 5:19197629-19197651 TCATTGCAACCACAGCCTCCTGG - Intergenic
988679620 5:33472135-33472157 TCATTGCCACCTCCACCTCCTGG - Intergenic
989561803 5:42860525-42860547 CCATAGTCACCAAAACATCATGG - Intronic
989659970 5:43788594-43788616 TGATTGCCTCAAAAACCTCCTGG + Intergenic
990233719 5:53743620-53743642 CCATAGTCACCAAAACCCCATGG + Intergenic
990712446 5:58600220-58600242 CCATAGTCACCAAAACATCATGG - Intronic
992789278 5:80198984-80199006 CCACTGCCACCACTACCTCTAGG + Intronic
993718047 5:91294945-91294967 GCATTGGCACCTCAACCTCCTGG + Intergenic
994487599 5:100399397-100399419 TCATTGCAACCACCACCTCCTGG + Intergenic
994655995 5:102593596-102593618 CCATTTCCTCCTAGACCTCCAGG + Intergenic
994925024 5:106104540-106104562 CCATAGTCACCAAAACAGCCTGG - Intergenic
995004552 5:107175592-107175614 ACATTGCAACCAAAAACTCATGG + Intergenic
995317583 5:110793547-110793569 CCATAGTCACCAAAACATCATGG - Intergenic
996561644 5:124836173-124836195 TCATTGAAACCAAAGCCTCCTGG - Intergenic
996704933 5:126487995-126488017 CCATTGCCATCAGCACCACCTGG - Intronic
997040307 5:130244713-130244735 TCATTGCAACCACCACCTCCTGG - Intergenic
998125890 5:139621166-139621188 TCATTGCAGCCTAAACCTCCTGG - Intronic
998242458 5:140460593-140460615 CCACTGCAACCTCAACCTCCTGG + Intronic
998324552 5:141268264-141268286 CCATTGCAACCTCCACCTCCCGG - Intergenic
1000332328 5:160215611-160215633 TCATTGCCACCTCAACCTCCTGG - Intronic
1000861755 5:166464252-166464274 CCATAGTCACCAAAACATCATGG - Intergenic
1001315023 5:170635899-170635921 CCACTGCCACCTGCACCTCCCGG - Intronic
1002569643 5:180132892-180132914 TCACTGCCACCACCACCTCCTGG - Intronic
1004657026 6:17672499-17672521 TCACTGCAACCAGAACCTCCTGG - Intronic
1005035296 6:21550621-21550643 TCATTGCCACCTTAAACTCCTGG - Intergenic
1005081509 6:21961084-21961106 TCACTGCCACCTAAAACTCCTGG + Intergenic
1005203435 6:23373367-23373389 TCACTGCCACCTCAACCTCCTGG - Intergenic
1006797855 6:36742530-36742552 CCCTGGCCCCCAAAATCTCCAGG + Intronic
1006946354 6:37787045-37787067 CCACTGCCACCCACTCCTCCTGG + Intergenic
1008556341 6:52676325-52676347 TCATTGCAACCTCAACCTCCAGG + Intronic
1008775026 6:55027747-55027769 CCATGGTCACCAAAACATCATGG - Intergenic
1008936327 6:56996370-56996392 TCACTGCCACCTCAACCTCCTGG - Intronic
1009867471 6:69415192-69415214 CCATAGTCACCAAAACATCATGG + Intergenic
1010649933 6:78441912-78441934 CCATTGTCACCAAATTCTTCTGG - Intergenic
1012467813 6:99535234-99535256 TCATTGCAACCTATACCTCCTGG + Intergenic
1012953671 6:105545481-105545503 GCATTGCCCACAAAACATCCTGG + Intergenic
1014065376 6:117118490-117118512 CCCTTACCACCACAACCTACTGG - Intergenic
1014238579 6:118989901-118989923 TCACTGCAACCAAAGCCTCCTGG + Intronic
1015866377 6:137730990-137731012 TCATTGCAACCTCAACCTCCTGG + Intergenic
1017191133 6:151653888-151653910 CCATTGCAACCTCTACCTCCTGG + Intergenic
1018270610 6:162073524-162073546 TCACTGCAGCCAAAACCTCCTGG + Intronic
1018414285 6:163587831-163587853 CCATTGCAACCTCCACCTCCTGG - Intergenic
1019532293 7:1509877-1509899 CCATTGCAACCTCCACCTCCTGG + Intergenic
1019747255 7:2707896-2707918 TCATTGCCACCTCTACCTCCTGG + Intronic
1020700013 7:11468757-11468779 CCATTGCAACCTCAGCCTCCTGG - Intronic
1020742072 7:12032948-12032970 CCATTGCCACAGAGACCTGCTGG - Intergenic
1021476208 7:21064453-21064475 CCATTGCAACCAAAAGGCCCTGG + Intergenic
1022211448 7:28214155-28214177 CCATTGCCATCCAAGCCTTCAGG + Intergenic
1022949612 7:35323715-35323737 CCATTGCAATCAAAATCTCTGGG - Intergenic
1024313043 7:47987606-47987628 TCATTGCCACCTCTACCTCCTGG + Intronic
1024739203 7:52336868-52336890 CGATTGCCTCAAAAGCCTCCTGG - Intergenic
1025619670 7:63157070-63157092 TCATTGCCACCTCCACCTCCCGG - Intergenic
1028003842 7:85536907-85536929 TCATTTCCCCCAAAACCTCATGG - Intergenic
1028132881 7:87197479-87197501 GTATTAACACCAAAACCTCCTGG - Intronic
1028924699 7:96345325-96345347 CCACTGCAACCTCAACCTCCTGG - Intergenic
1029642864 7:101832162-101832184 CCATGACCACCACACCCTCCTGG - Intronic
1031328658 7:120435179-120435201 TCATTGCAACCACCACCTCCCGG + Intronic
1031777387 7:125920093-125920115 CGATTGCCTCCGAAACCTACAGG + Intergenic
1032449195 7:132014403-132014425 CCATTGTCACCAAAACAGCATGG - Intergenic
1034620871 7:152456180-152456202 CCACTGCCACAGAAACATCCCGG + Intergenic
1034721766 7:153299944-153299966 TCATTGCAACCACTACCTCCCGG - Intergenic
1034769595 7:153760790-153760812 CCACTGCCTCCAATACTTCCAGG + Intergenic
1037368970 8:18153129-18153151 TCATTGCCACCTTGACCTCCTGG + Intergenic
1038047656 8:23779776-23779798 TCATTGCAACCTTAACCTCCTGG - Intergenic
1038583805 8:28771933-28771955 TCATTGCAACCTCAACCTCCTGG + Intronic
1039498958 8:38001903-38001925 CGATTGCCATGGAAACCTCCTGG - Intergenic
1040442443 8:47457973-47457995 CCATAGCCACCAAAACAGCATGG - Intronic
1041280877 8:56210629-56210651 CATTTTCCACCAAAACATCCCGG - Intronic
1041631104 8:60088096-60088118 CCATTGCCTCAAAATACTCCTGG - Intergenic
1041638163 8:60167016-60167038 CCATAGTCACCAAAACAGCCTGG + Intergenic
1041741194 8:61158899-61158921 TCACTGCCACCTCAACCTCCTGG + Intronic
1042106310 8:65330723-65330745 CCATTGCCACTAAAACTTGACGG + Intergenic
1042243579 8:66689072-66689094 GCATTGCCACTATGACCTCCAGG + Intronic
1042456753 8:69014223-69014245 TCACTGCCACCTTAACCTCCTGG + Intergenic
1043086621 8:75842878-75842900 TCACTGCAACCTAAACCTCCAGG + Intergenic
1043628089 8:82289711-82289733 CCATTGTCACCAAAACAGCACGG - Intergenic
1043849121 8:85195562-85195584 CCACTGCAACCTCAACCTCCTGG + Intronic
1045435091 8:102154612-102154634 CCATTCCTACCCAAATCTCCTGG - Intergenic
1045531568 8:102989889-102989911 CCATTGCAGCCTCAACCTCCTGG + Intergenic
1045828083 8:106425176-106425198 TCATTGCAGCCTAAACCTCCTGG + Intronic
1046507127 8:115150601-115150623 TCACTGCAACCTAAACCTCCTGG + Intergenic
1048500379 8:134969864-134969886 CCTTTGCCTCCAAAAGCTCTGGG + Intergenic
1049089840 8:140506430-140506452 TCAATGCCACCTAAACCTCCCGG + Intergenic
1049231514 8:141487237-141487259 CCATTTCCCCCCAAACCCCCTGG + Intergenic
1049756457 8:144313259-144313281 CCACTGCCACCAAGGCCCCCAGG + Intronic
1050358792 9:4808380-4808402 TCATTGCCACCTCCACCTCCTGG + Intronic
1051190267 9:14504207-14504229 CCATAGTCACCAAAACATCATGG - Intergenic
1051426297 9:16934952-16934974 CCATTGCAACCTCCACCTCCCGG + Intergenic
1051575813 9:18614290-18614312 TCATTGCCATCTAAACCTCAAGG + Intronic
1052638480 9:31133157-31133179 CCATAGTCACCAAAACATCATGG + Intergenic
1052826675 9:33181347-33181369 TCACTGCCACCTCAACCTCCTGG - Intergenic
1056621818 9:88221236-88221258 CCCCTTCCCCCAAAACCTCCTGG + Intergenic
1056867744 9:90244709-90244731 CCACTGCAACCACCACCTCCTGG + Intergenic
1057782261 9:98059487-98059509 TCATTGCCACCTCAACCTCTGGG + Intronic
1058251847 9:102707788-102707810 TCTGTGCCACCAAAAACTCCTGG + Intergenic
1058574792 9:106389025-106389047 CCATTTCCACCAAAGACTGCAGG + Intergenic
1058700436 9:107595860-107595882 TCATTGCAACCTCAACCTCCTGG + Intergenic
1059041347 9:110818498-110818520 CCATTGCAACCTCCACCTCCCGG - Intergenic
1059876178 9:118637613-118637635 ACATTGCTATCATAACCTCCTGG - Intergenic
1061518741 9:131104821-131104843 CCACTGCAACCTCAACCTCCTGG - Intronic
1062049251 9:134438618-134438640 CCATTTCCACCACACCCGCCAGG - Intronic
1203770692 EBV:48536-48558 CGATCGCCACGAAAACATCCCGG - Intergenic
1185876541 X:3706558-3706580 CCACTGCAACCTCAACCTCCTGG + Intronic
1187246340 X:17555792-17555814 CCTAGGCCCCCAAAACCTCCTGG - Intronic
1187430670 X:19221517-19221539 CCATTGTCACCAAAACAGCATGG - Intergenic
1188231198 X:27665685-27665707 CCATAGCCACCCCAACCTTCAGG + Intronic
1188794390 X:34443572-34443594 CCATAGTCACCAAAACATCATGG + Intergenic
1189056514 X:37704758-37704780 CCACTGCCACCTCCACCTCCAGG - Intronic
1190111344 X:47590965-47590987 TCATTGCAACCTCAACCTCCTGG + Intronic
1192014090 X:67310019-67310041 CCATAGTCACCAAAACATCATGG - Intergenic
1192150833 X:68711492-68711514 CATTTGCCCCCAAAACCTGCAGG + Intronic
1192164334 X:68817325-68817347 CCATAGCCACCAAAACAGCATGG + Intergenic
1192310161 X:70005019-70005041 CCATTGCAGCCTTAACCTCCTGG - Intronic
1192454635 X:71266667-71266689 CGATCGCCTCAAAAACCTCCTGG + Intergenic
1193323251 X:80149366-80149388 CCATTGTCACCAAAACAGCATGG - Intergenic
1193590927 X:83388037-83388059 CCATAGTCACCAAAACATCATGG + Intergenic
1193870404 X:86790619-86790641 TCACTGCCACCTCAACCTCCTGG + Intronic
1193937897 X:87644665-87644687 CCATAGTCACCAAAACATCATGG + Intronic
1193988931 X:88281877-88281899 CCATTGCAACCTCAACCTCCTGG - Intergenic
1194969051 X:100322449-100322471 CCATAGTCACCAAAACATCATGG - Intronic
1195556877 X:106236853-106236875 CCATAGTCACCAAAACAGCCTGG + Intergenic
1198747620 X:139906340-139906362 CCACTGCAACCTCAACCTCCCGG - Intronic
1199595938 X:149505733-149505755 CCAGTGCCACCAACAGCGCCTGG - Intronic
1199644517 X:149893319-149893341 TCATTGCAACCTACACCTCCCGG - Intergenic
1200062560 X:153490072-153490094 CCACTCCCACCAGAGCCTCCTGG + Intronic
1200124805 X:153808192-153808214 CCAAGGGCTCCAAAACCTCCAGG - Intronic
1201670880 Y:16518861-16518883 CCATTGCAACCTCCACCTCCTGG + Intergenic