ID: 1104643595

View in Genome Browser
Species Human (GRCh38)
Location 12:130482322-130482344
Sequence CCTACTAGGTGCCAAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104643595 Original CRISPR CCTACTAGGTGCCAAGAAGC TGG Intronic
900002568 1:22787-22809 TCTACAAGGTGCCAAGTACCAGG + Intergenic
900022287 1:193312-193334 TCTACAAGGTGCCAAGTACCAGG + Intergenic
901655015 1:10764334-10764356 CCTACTATGTGCCAGGCGGCAGG + Intronic
902436258 1:16399858-16399880 CCTACTATGTGCCAAGTAACAGG - Intronic
902961618 1:19967614-19967636 CCTTGTAAGTGCCAAGAGGCAGG + Intergenic
903015082 1:20356287-20356309 CCTCCTAGGTGCCCTGGAGCTGG + Intergenic
903455092 1:23482087-23482109 CCTACTATGTGCAAAGTAGTAGG + Intronic
905016725 1:34782932-34782954 CCTACTATGTGCCAAGCACTGGG + Intronic
905421264 1:37846882-37846904 TGTGCTAGGTGCCCAGAAGCAGG - Intronic
906343696 1:45002455-45002477 CCTACTCGGAGCCAAGAAGATGG - Intergenic
907170382 1:52457685-52457707 TCTACTTTGTGCCAAGAATCAGG + Intronic
908420424 1:63953619-63953641 CCTACTAGGTGCCAAGCACTGGG - Intronic
909399170 1:75207248-75207270 AAAACTAGGTGTCAAGAAGCTGG - Intronic
912710464 1:111946065-111946087 CCTACTATGTGCCAAGCACTGGG - Intronic
913318977 1:117575691-117575713 CTTACTGGCTGCCATGAAGCTGG - Intergenic
915317818 1:155039455-155039477 CCTACTAGTACCCAAGATGCTGG + Exonic
919490196 1:198197102-198197124 ACTACTATGTGCCAAGTACCGGG - Intronic
921045476 1:211474004-211474026 CCTACTGTGTGCCCAGAAGATGG + Intergenic
921139177 1:212289281-212289303 CTTACTAGGTGTGAAAAAGCAGG - Intronic
923154726 1:231268446-231268468 CGTACTAGGTGCCAAGGAAATGG - Intronic
1066352747 10:34651936-34651958 CCTAAGAAGTTCCAAGAAGCAGG + Intronic
1067780038 10:49195346-49195368 CCTCATAGGAGCCAAGGAGCTGG + Intergenic
1070665177 10:78337600-78337622 CCTACTACGTGTCCAGAAGGTGG + Intergenic
1072551874 10:96484852-96484874 CCTACTATGTGCCAAGAACAGGG - Intronic
1074568431 10:114602420-114602442 TCTGCTATGTCCCAAGAAGCTGG - Intronic
1074883467 10:117676524-117676546 CCTACTATGTGCCAGGCATCAGG - Intergenic
1075687989 10:124377294-124377316 CCTACTTGGTGCCAACAGCCGGG - Intergenic
1076722688 10:132399630-132399652 CCTACTGTGTGCCAGGAAGTGGG + Intronic
1077374784 11:2200405-2200427 CCGACGGGGAGCCAAGAAGCGGG - Intergenic
1077628621 11:3795614-3795636 CCTACTATGTGGCAAGCAACTGG + Intronic
1077975422 11:7243369-7243391 CCTACTCTGTGCAAAGAACCAGG - Intronic
1081318251 11:41658396-41658418 CCTACTAGGTTCCATGAAGTTGG + Intergenic
1083213926 11:61206763-61206785 CCTACTACGTGCCAAGCACTGGG + Intronic
1083216810 11:61225592-61225614 CCTACTACGTGCCAAGCACTGGG + Intronic
1083219692 11:61244418-61244440 CCTACTACGTGCCAAGCACTGGG + Intronic
1083785605 11:64944415-64944437 TCTACTATGTGCCAAGTACCAGG - Intronic
1083811335 11:65108461-65108483 CCCAGCAGGTGCCGAGAAGCTGG + Exonic
1083901120 11:65644079-65644101 ACTCCTGGGGGCCAAGAAGCTGG - Intronic
1084176224 11:67423755-67423777 CCTGCCAGGTGTCATGAAGCTGG + Exonic
1089138070 11:116265293-116265315 CCTGCTAGGTCCCAAGAGGGTGG + Intergenic
1091375986 12:24850-24872 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1092121206 12:6045151-6045173 CCTACTAATTGCCACGAAGTAGG - Intronic
1094703671 12:32895233-32895255 CATACTATGTGCCAAGAATTGGG - Intronic
1100482137 12:94989310-94989332 CCTACCAGGTGCCAAGAACCTGG - Intronic
1102214395 12:111150132-111150154 CCTACTATGTGCCAGGGCGCTGG - Intronic
1102633836 12:114305135-114305157 CCTACTATGTGCCAGGCAGTAGG - Intergenic
1102794928 12:115680887-115680909 CTTCCTATGTGCCTAGAAGCTGG - Intergenic
1104643595 12:130482322-130482344 CCTACTAGGTGCCAAGAAGCTGG + Intronic
1106760044 13:32859183-32859205 CCTCCTAGGGGCCAAGAGACTGG - Intergenic
1107249094 13:38336079-38336101 CCTACTAGCTGCCAAGCAGCTGG + Intergenic
1110188164 13:72699406-72699428 TCTACTATGTGCCAAGCACCAGG + Intergenic
1110620026 13:77584980-77585002 CCTACTAGGTGCCAGGTACTTGG - Intronic
1114482299 14:23043346-23043368 CGGACTTGGTGCCAAGAAGGAGG - Exonic
1115315319 14:32019328-32019350 CCTACTTGCTTCCAAAAAGCTGG + Intergenic
1117464052 14:55974710-55974732 CCTACTATGTGCCAAGCACCAGG + Intergenic
1118745865 14:68772658-68772680 CCTACTATGTGCCAAGAGTGGGG - Intergenic
1119984292 14:79118317-79118339 CCTACTATGTGCCCAGAACATGG - Intronic
1120885224 14:89446724-89446746 CCTACTATGTGCCAGGCACCTGG - Intronic
1121009241 14:90510201-90510223 GCTACTATGTGCCAAGCACCAGG - Intergenic
1122083375 14:99282615-99282637 CCTACTTTGTGCCAAGGACCAGG + Intergenic
1122265171 14:100543334-100543356 CCTACTAGGCTCCAAGATGATGG - Intronic
1122279055 14:100610552-100610574 CCTCCTGTGTGCCCAGAAGCTGG + Intergenic
1124951474 15:34325782-34325804 CCCACTAAGTGCCAAGAAATAGG + Intronic
1125076309 15:35622897-35622919 CTAACCAGGTGCCAAGAAGTAGG - Intergenic
1125094657 15:35837498-35837520 CCTCCTAGGTCCCCAGTAGCAGG + Intergenic
1125335620 15:38623514-38623536 CCTACTATGTGCCAGGAACTTGG - Intergenic
1126360706 15:47842841-47842863 CCATCTAGGAACCAAGAAGCAGG + Intergenic
1128899252 15:71404730-71404752 GCAACAAGGTGCCATGAAGCAGG + Intronic
1132450942 15:101968152-101968174 TCTACAAGGTGCCAAGTACCAGG - Intergenic
1133589942 16:7232432-7232454 CCTAATAGTTGCCAGGAACCTGG - Intronic
1137625527 16:49905707-49905729 CCTACTATGTGCCAAGCACCGGG - Intergenic
1138115485 16:54357494-54357516 CCCACCAGGGGCAAAGAAGCTGG - Intergenic
1139222673 16:65200402-65200424 CCTATTTTGTGCCAAGAAGTTGG + Intergenic
1139447011 16:67004179-67004201 CCTTCTAGGTGTCAACAACCTGG + Exonic
1140219389 16:73032964-73032986 CCCACTGGGTGCCAGGCAGCAGG + Intronic
1140239134 16:73185243-73185265 CCTACTATGTGCCGGGAAGTGGG + Intergenic
1141379964 16:83567303-83567325 CCCACTATGTGCCAAGAACCAGG - Intronic
1141446173 16:84060103-84060125 CCCACTAAGTGCCAAGCAGCTGG + Intronic
1143028874 17:3956304-3956326 CCTACTATGTGCCCACAAGGTGG - Intronic
1143146576 17:4780524-4780546 CCTACTATGTGCCAAGATTGGGG + Intronic
1145889117 17:28402592-28402614 CCTACTAAGTGCCAAGTGGGTGG - Exonic
1147472654 17:40677284-40677306 CCTACTGGGTGCATAGAAACTGG + Intergenic
1147638349 17:41977981-41978003 CCTACTAGGTGCAAAGTACTAGG + Intronic
1148683449 17:49487470-49487492 CCTACAGGGTGCCCAGAAGAGGG - Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149288854 17:55196009-55196031 CCTACTATGTGCCAAGCAGTAGG - Intergenic
1151617974 17:75226813-75226835 TCCATTAGGTGCCAAGAAACAGG - Intronic
1152167395 17:78718944-78718966 CCTACTAGGTGGAAGGCAGCGGG + Intronic
1154059277 18:11044345-11044367 CCTTACAGGTGCAAAGAAGCGGG - Intronic
1155162724 18:23208701-23208723 CCTACAAGGTGCCACAAAACTGG + Intronic
1156290955 18:35748216-35748238 CCTACTGTGTGCCAGGCAGCAGG + Intergenic
1157157941 18:45285938-45285960 CCAATTAGGTGAGAAGAAGCTGG - Intronic
1157763983 18:50283914-50283936 CATTCTACGTGCCAAGCAGCAGG - Exonic
1158373407 18:56834190-56834212 TCTACTAGGTGCCAGCAAGGTGG + Intronic
1159624435 18:70675573-70675595 CCTACTGGGTACCAAGATGGTGG - Intergenic
1160634320 19:64395-64417 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1161384980 19:3986469-3986491 CCTACTATGTGCTAAACAGCGGG - Intergenic
1164770993 19:30808871-30808893 GCTAATAGGAACCAAGAAGCTGG - Intergenic
1164852041 19:31492104-31492126 CCTTCTATGAACCAAGAAGCGGG - Intergenic
1165441943 19:35833512-35833534 TCTACTAGCTGTCAAGAAGATGG + Intronic
1166884049 19:45948236-45948258 CCTACTATGTGCCAAGCATAGGG + Intronic
1167044597 19:47042335-47042357 CCTTCTAGCTGCCATGAAGGAGG + Intronic
928297537 2:30097437-30097459 CCTGCTATGTGCCAGGAAGGAGG - Intergenic
928300550 2:30120537-30120559 CCTACAAGTTACTAAGAAGCAGG - Intergenic
930991146 2:57656015-57656037 CCTACTTGTTGCTAAGAATCTGG - Intergenic
933699254 2:85242989-85243011 ACTACTATGTGCCAAGATGTCGG - Intronic
935416568 2:102825352-102825374 TCTAATAGGTAACAAGAAGCAGG + Intronic
936567155 2:113590632-113590654 TCTACAAGGTGCCAAGTACCAGG - Intergenic
937494523 2:122403605-122403627 CCTACAGGGTGCTAGGAAGCTGG + Intergenic
938754724 2:134369104-134369126 CCTACCACGTGCCAGGCAGCTGG - Intronic
939293359 2:140223425-140223447 CCTACGAGGTGGCAAGAAATGGG - Intergenic
942055712 2:172180410-172180432 ATTATTAGGTGACAAGAAGCAGG - Intergenic
943843414 2:192608235-192608257 CCTAATAGGTTCCACGTAGCAGG + Intergenic
944478752 2:200133154-200133176 AGTACTAGGTGACAAGAAGATGG + Intergenic
946671172 2:222105949-222105971 CCTTCTAGGAGCCCTGAAGCTGG - Intergenic
1169274945 20:4227469-4227491 CCTACTAGATGCCAAGTGGTAGG - Intronic
1169752882 20:9012820-9012842 CCTACTATGTGCCAGGCAGTAGG - Intergenic
1169809742 20:9597292-9597314 CCTACAAAGTGCAAAGCAGCTGG + Intronic
1173185676 20:40838170-40838192 TCTACTAGGTGCCAAGTTCCAGG + Intergenic
1175451678 20:59074300-59074322 CCAACTTGGTGCCGAAAAGCTGG - Intergenic
1176893244 21:14344744-14344766 TCTACTATGTACCAAGAACCTGG + Intergenic
1177409701 21:20713460-20713482 CCTACCAGGTAGGAAGAAGCTGG - Intergenic
1182089964 22:27587759-27587781 CATTCTAGGTGACAAGAAGCAGG - Intergenic
1182116531 22:27759704-27759726 CCTACTGTGTGCTAGGAAGCAGG - Intronic
1182125965 22:27816034-27816056 CCTACTATGTGCCAGGCACCAGG + Intergenic
1182806725 22:33078388-33078410 CCTACTATGTGCCAGGACCCAGG + Intergenic
1183235925 22:36617615-36617637 CCTACTAGATGCCCAGGATCAGG - Intronic
950114514 3:10441951-10441973 CCTACTATGTGCCCAGAAAAGGG - Intronic
950169968 3:10832181-10832203 GCCACTAGGAGCCAAGAGGCTGG - Intronic
950655039 3:14431372-14431394 AATACTAGGTGTCAGGAAGCAGG + Intronic
951593891 3:24296472-24296494 CCTACTATGTGCCAAGGCACAGG + Intronic
951786257 3:26422465-26422487 CCTACTATGTGCCCAGCATCGGG - Intergenic
952966203 3:38622707-38622729 CCTATTAGGTGTCATGGAGCAGG - Intronic
954201890 3:49028343-49028365 ACTACTAAGTGACAAGAAGCAGG + Intronic
969517291 4:7654745-7654767 CCTACTGGGTGCCAATGAGCAGG + Intronic
969693512 4:8721595-8721617 CCTACTATCTGCCAGGTAGCAGG - Intergenic
969974684 4:11086540-11086562 CAACCTAGGTGCCAAGATGCAGG + Intergenic
971051058 4:22863179-22863201 CGTACTTGCTGCCAATAAGCAGG + Intergenic
978949874 4:114545249-114545271 CCTACTATGTGCCAAAAAGTGGG - Intergenic
984701243 4:182819982-182820004 CCTGGTGGGTGCCAAGGAGCTGG - Intergenic
985940220 5:3129238-3129260 CCCAGTGGGTGCCAAGAAGATGG + Intergenic
986075124 5:4328368-4328390 CCATCTATGTGCCAAGAAACTGG - Intergenic
988245436 5:28674808-28674830 CCTCCTAGGTGCCCTGAAGTTGG + Intergenic
989709258 5:44377250-44377272 TCTACTCAATGCCAAGAAGCAGG - Intronic
990983348 5:61620769-61620791 CTTAGTAGGTGCCAAGAGACGGG + Intergenic
994023388 5:95053688-95053710 CCTACCAGGTACCAAGCAGTAGG + Intronic
995684350 5:114756112-114756134 CCTACTATCTGCCAGGAAGCAGG - Intergenic
995740604 5:115352335-115352357 GCTACTATGTGCCAGGCAGCAGG + Intergenic
998605203 5:143626724-143626746 TCTACTAGGTGCCAAGCAGTGGG + Intergenic
999150260 5:149421872-149421894 CCAACTAGGAGCCAAGAATCCGG + Intergenic
1000855047 5:166387774-166387796 CCTATTTGGTGTCAAGAAGATGG + Intergenic
1001931975 5:175679619-175679641 CCTCCTAGATGCCTAAAAGCAGG - Intronic
1002533415 5:179863014-179863036 CCAACCTGGTGCCAAGAGGCAGG + Exonic
1005401636 6:25440049-25440071 CCTACTATGTGCCAAGAACTAGG - Intronic
1010941129 6:81918833-81918855 CCTACCATGTGACAAGAAGAAGG - Intergenic
1011388258 6:86821235-86821257 CCTAGTAGATGGCAATAAGCAGG - Intergenic
1012528463 6:100205528-100205550 CCTACTAGGTGCCAGGCAATGGG - Intergenic
1013501934 6:110760752-110760774 CCTACAACGTGCTATGAAGCAGG + Intronic
1019571723 7:1715952-1715974 CCTGCTGGGTGCCAAACAGCAGG - Intronic
1021378182 7:19934759-19934781 CCAACTGGGAGCAAAGAAGCAGG - Intergenic
1021937489 7:25645760-25645782 CCTACTATATGCCAAGACCCAGG + Intergenic
1023498531 7:40823941-40823963 CCTAGTAGGTTCCAAGTATCAGG + Intronic
1023758648 7:43443916-43443938 CCTACTATGTGCCCAGAACTGGG + Intronic
1026071278 7:67122734-67122756 CCTACTACTGGCCAACAAGCAGG - Intronic
1026273677 7:68858358-68858380 CCTACCAGGAGCTAAGAAGTGGG - Intergenic
1026705614 7:72689551-72689573 CCTACTACTGGCCAACAAGCAGG + Intronic
1026742937 7:72990327-72990349 CCTACTGGGAGCCCAGAAGGTGG + Intergenic
1027100798 7:75374751-75374773 CCTACTGGGAGCCCAGAAGGTGG - Intergenic
1029087533 7:98022936-98022958 CCTAGTAAGTGCCCAGGAGCTGG - Intergenic
1029142660 7:98422632-98422654 CCTACCATGTACCAAGAAGGGGG - Intergenic
1031949174 7:127873993-127874015 CCTGCAAAGGGCCAAGAAGCAGG + Intronic
1032157802 7:129483851-129483873 CCTCCCAGCTGCCAAGTAGCTGG + Intronic
1032681635 7:134190764-134190786 CCTACTATGTGCCAAGCATTGGG + Intronic
1035271574 7:157722905-157722927 CCTACCAGGTGCCAGGAACAGGG - Intronic
1039102728 8:33958068-33958090 CCCACCAGGTGAGAAGAAGCAGG + Intergenic
1039229034 8:35422726-35422748 CCTACTATGTGCCAGGTAGTAGG + Intronic
1042836623 8:73084922-73084944 CCTACCATGTGCCAAGCACCAGG - Intronic
1043711385 8:83423118-83423140 CCTGCTAGGTCCTAAGCAGCTGG + Intergenic
1046847479 8:118934232-118934254 CCTACTAGGTGTCAAGCACCAGG + Intronic
1047495668 8:125406971-125406993 CCTACTATGTGCCAGGCACCAGG - Intergenic
1048989686 8:139753953-139753975 CCTGCTCTGTGCCAAGGAGCAGG - Intronic
1049885376 9:22900-22922 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1050131309 9:2415523-2415545 ACTACTTGGTGCCGAGAAACAGG + Intergenic
1050524993 9:6538567-6538589 CCTACTATGTGCCAGGCACCTGG + Intronic
1051916456 9:22214362-22214384 CCTACTATGTACCAGGAAACTGG + Intergenic
1053432791 9:38054264-38054286 CCCACAAGGGGCCAAGAAGCAGG + Intronic
1058108734 9:101005525-101005547 CTTACTATGAGCCAAGAAGCTGG + Intergenic
1058703745 9:107621986-107622008 CCTACTATGTGCCAGGAAAAGGG - Intergenic
1060516563 9:124269736-124269758 CCTACTATGTGCCAGGCACCGGG - Intronic
1203791657 EBV:154881-154903 CCTACTGGGGGCCAAGAAGGAGG - Intergenic
1186313257 X:8342740-8342762 CCTACTATTTGCCAGGCAGCAGG + Intergenic
1193348376 X:80430102-80430124 CCTAATGGCTGCCAAAAAGCAGG - Intronic
1195467204 X:105192543-105192565 CCTACTAGATTCCAACAAGTTGG - Intronic
1196802207 X:119553892-119553914 CTAACTATGTGCCAAGAAGCAGG + Intronic
1198389636 X:136161234-136161256 GCCAATAGGTGGCAAGAAGCAGG - Intronic
1198650970 X:138863697-138863719 CCTACTAGGTGCCAGGCAATGGG - Intronic
1199060312 X:143348267-143348289 CTTATATGGTGCCAAGAAGCAGG - Intergenic
1199942373 X:152638497-152638519 CCTTCTAGGGGCCAACAGGCAGG - Intronic
1200132653 X:153859585-153859607 CCTACTGGGTGCATAGAGGCTGG + Intergenic