ID: 1104643780

View in Genome Browser
Species Human (GRCh38)
Location 12:130483491-130483513
Sequence GCTGCAGTCCTGCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 570}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104643780 Original CRISPR GCTGCAGTCCTGCTGGGGGC TGG Intronic
900144358 1:1151436-1151458 GCGGCACTCCTGCTGGGTGGGGG - Intergenic
900189473 1:1347232-1347254 GCTGCAGACTTACAGGGGGCTGG - Intronic
900405630 1:2491784-2491806 CCCGCAGTCCTGCTGTGGGTGGG + Intronic
900405670 1:2491949-2491971 CCCGCAGTCCTGCTGCGGGTGGG + Intronic
900481421 1:2901288-2901310 GCTGCAGACCTGGTTGGGGCTGG + Intergenic
900571582 1:3361276-3361298 TCTCCAGCCCTGTTGGGGGCTGG - Intronic
900586424 1:3434589-3434611 GCTGCAGGCCTGCCCGAGGCTGG + Exonic
901493086 1:9606521-9606543 CATGCAGTCATGCTGGGCGCAGG + Intronic
901762431 1:11479608-11479630 GCTGCAGTCCCGCGGGGAGATGG - Intronic
902286066 1:15409644-15409666 GGAGGGGTCCTGCTGGGGGCCGG - Intergenic
902730411 1:18365290-18365312 CCTGCTGTCCTGTAGGGGGCCGG - Exonic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904386494 1:30145943-30145965 GCTGCAGTGCTGCCAGGGGAGGG + Intergenic
904408789 1:30312342-30312364 GGGGCAGGGCTGCTGGGGGCAGG + Intergenic
904921733 1:34013468-34013490 GCTGAGCTCCTGCTGGGAGCTGG + Intronic
905605555 1:39296102-39296124 GCTGCAGACAGGCTGGGGGCTGG + Intronic
905915970 1:41684455-41684477 GCTGCCCTCCTGCTGGGGTCAGG + Intronic
906294629 1:44641923-44641945 GCTGCTGCCCGGCTGGGAGCTGG + Intronic
906322744 1:44827108-44827130 GCTGCAGGCCTCCTGGGCCCAGG - Intronic
906544533 1:46611970-46611992 GCTCCAGGCCAGGTGGGGGCTGG + Intronic
906680788 1:47724419-47724441 GCTCCTGTCCTGGTGGGAGCTGG + Intergenic
908190111 1:61693999-61694021 GCTGCAGTGGGACTGGGGGCGGG - Intronic
909960117 1:81829876-81829898 ACTGCAGTCCTTGTAGGGGCAGG + Intronic
911275669 1:95854541-95854563 GCTGCAGCCCTGCAGAGAGCTGG + Intergenic
911700773 1:100949727-100949749 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
912798624 1:112707228-112707250 GCTGCGGCCCTGCGCGGGGCCGG - Intronic
913030059 1:114892713-114892735 GCTGCAGTCCTGCTGTTGGTAGG + Intronic
914681824 1:149944151-149944173 GATGCTGTCCTGGTGGGGGTAGG + Exonic
914905400 1:151739682-151739704 GCTTCAGTCCTGATGGGGGTGGG - Intergenic
915088855 1:153407401-153407423 GCGGCAGTGAGGCTGGGGGCAGG + Intergenic
915317045 1:155034515-155034537 ACTGCTCTCCTGCTGGGGGCAGG + Exonic
915354504 1:155248066-155248088 GCTCCAGTCCCACTGGGGTCTGG + Exonic
916588420 1:166167020-166167042 GCTGCCGTCCGGGTGGGGGGGGG + Intergenic
916732508 1:167579324-167579346 TCTGCAGTCAAGCTGTGGGCAGG - Intergenic
917671091 1:177274270-177274292 CCTGCAGGCATCCTGGGGGCAGG + Intronic
918984678 1:191608676-191608698 GCTGCAGGCATTCGGGGGGCAGG + Intergenic
919536073 1:198789284-198789306 CCTCCAGGCCTGCTGGGGGTGGG + Intergenic
919744542 1:201000309-201000331 GCAGCAGTCCTCCTTGGGGACGG + Intronic
919847423 1:201650517-201650539 GCTGCCCGCCCGCTGGGGGCTGG + Intronic
919887048 1:201942203-201942225 GCTGAAGGCCTGCTGTGTGCTGG + Intronic
919892154 1:201983158-201983180 GGTGCAGGGCGGCTGGGGGCCGG - Intronic
919939512 1:202276549-202276571 AGTGGGGTCCTGCTGGGGGCTGG + Intronic
920054692 1:203183544-203183566 GCTGCTGTCCTCCTGAGGACAGG - Intronic
920129807 1:203723492-203723514 GCTGCACTCCCCCTGGGGGAGGG - Intronic
920307600 1:205029212-205029234 GCTGCAAACCTGCGGAGGGCAGG + Intergenic
921013224 1:211162667-211162689 GGTGCAGTGCTGCTGGCGGCTGG + Intergenic
922187067 1:223285200-223285222 ACTGCAGTCTTGTTGGGGACAGG + Intronic
922665426 1:227464916-227464938 GCACCTGTCCTGCTTGGGGCTGG - Intergenic
923542586 1:234899210-234899232 CCTGCAGTCATGCTGGGCTCTGG - Intergenic
924286677 1:242494348-242494370 GCTGCAGACCTGCATGTGGCAGG - Intronic
924741318 1:246795623-246795645 GCTGCATTCCTGCTGCTGCCGGG - Intergenic
1063010023 10:2012442-2012464 CCTGGAGTCCTGCTGGGGGACGG + Intergenic
1063063035 10:2577999-2578021 GCTGCACACCTGCTGCGGGAGGG + Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1064828893 10:19439413-19439435 CCTGCAGTCCTGATGGTGGGAGG + Intronic
1065201353 10:23316257-23316279 GCTGCAGCCTTGCAGGGAGCTGG - Intronic
1066406841 10:35126862-35126884 GCTTCACTCCTGCTGGCGGCCGG + Intronic
1067178818 10:43969929-43969951 ACTGCAGTCCTGCTTGGCACTGG + Intergenic
1067695744 10:48534392-48534414 GCTGCATTTCTCCTGGGGGTGGG - Intronic
1068253045 10:54469531-54469553 GGTGAAGTCTTGCTGGGGACAGG + Intronic
1068738083 10:60437440-60437462 CCTGCAGTGCTGCAGGGGCCAGG + Intronic
1069490744 10:68858364-68858386 ACTGCAGTCCTGCTGAGGAGCGG + Intronic
1070003730 10:72402033-72402055 GGTCCTGTCCTGCTAGGGGCTGG - Intronic
1070343641 10:75521423-75521445 GCTGCAGTCAGGCAGGGGGAGGG - Intronic
1071166344 10:82811801-82811823 CCAGCAGTCCTCCAGGGGGCAGG + Intronic
1072100741 10:92226919-92226941 GCTGCAGTTCTGAAGGGGGAGGG - Intronic
1072379994 10:94858240-94858262 GCAGCAGCCTTGCTGGGGGAGGG - Intergenic
1072566205 10:96618851-96618873 GCTGCAGTCCTGCTGAGAAAAGG - Intronic
1073035757 10:100563127-100563149 GGTTCTGTCCTGATGGGGGCAGG + Intergenic
1073178753 10:101571322-101571344 GCTACAGCCCTGCTGGAGGCAGG - Intronic
1074404121 10:113165834-113165856 GCTGCAAAGCGGCTGGGGGCAGG - Exonic
1075090613 10:119442221-119442243 TCTGCAGGGCTGCTGGGGGGCGG + Intronic
1076001990 10:126919735-126919757 CCTCCAGTCCCCCTGGGGGCAGG + Intronic
1076358306 10:129868755-129868777 GCTGCAGGCCTGGTGGAGGCCGG + Intronic
1076898177 10:133324578-133324600 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1076898186 10:133324611-133324633 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1076898195 10:133324644-133324666 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1076999084 11:313622-313644 GCTGCAGTCCTGCTCTGTGCGGG - Intronic
1077099992 11:818465-818487 GCCCCAGCCCTACTGGGGGCCGG - Intergenic
1077350724 11:2091996-2092018 TCTGCAGCCATGCTGGTGGCTGG - Intergenic
1078036123 11:7806678-7806700 GCTGAAGTTTTGCTGGGGACTGG - Intergenic
1078181937 11:9019091-9019113 GCTGTGATCCTGTTGGGGGCTGG - Intergenic
1079683790 11:23331556-23331578 GGTGCAGTTTTGCTGGGGACTGG + Intergenic
1081368826 11:42272858-42272880 GCTGCTGTGCTGCTGGGGCCAGG + Intergenic
1081496626 11:43617687-43617709 GCTGTATTCCTGCTGTGTGCTGG - Intronic
1083259279 11:61514450-61514472 GCTTCACTCCTGGTGGGGGCAGG + Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083412829 11:62505765-62505787 CCAGGGGTCCTGCTGGGGGCGGG - Intronic
1083616756 11:64030002-64030024 GCCTCAGTCCTGCTGGGGCTGGG + Intronic
1083705329 11:64510224-64510246 GCTGCAATCCTGCCTGGGGCGGG - Intergenic
1083802527 11:65054606-65054628 GCTCCACTCCTGAGGGGGGCAGG + Exonic
1084554680 11:69868705-69868727 GCTGCGGCCGGGCTGGGGGCTGG - Intergenic
1084720779 11:70904274-70904296 GGTGCAGGCAGGCTGGGGGCTGG + Intronic
1085032647 11:73282005-73282027 GCTGTAGCCCTGCAGGGAGCTGG - Intronic
1085089451 11:73697921-73697943 ACTGAAGTCCTACTGTGGGCTGG + Intronic
1085218268 11:74851043-74851065 GCTGCACTCTTCCTGGGGGTGGG + Intronic
1085264716 11:75230476-75230498 GCCCCAGCCCTGCTAGGGGCAGG - Intergenic
1085496735 11:76977689-76977711 GAGGCAGTGCTGGTGGGGGCCGG + Intronic
1085522539 11:77146849-77146871 GCTGGAGACCCTCTGGGGGCGGG + Intronic
1085579402 11:77637477-77637499 CCTGGAGGCCTGCTGGGAGCGGG - Intronic
1087311159 11:96545411-96545433 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088448622 11:109958999-109959021 GCTGCATTCCTTCTGGAGGCTGG - Intergenic
1089214780 11:116829096-116829118 GAATCAGTCCTGGTGGGGGCTGG + Intergenic
1089256217 11:117195685-117195707 GCTGCTGTCCTGCCTGGGGCTGG + Intronic
1089283997 11:117394162-117394184 GCTGCAGGCTTGCTGGGGCCAGG + Intronic
1089396818 11:118141471-118141493 GCTGCAGGCCTGGGGAGGGCTGG - Intronic
1089607233 11:119648536-119648558 CCAGCTGTCCTGCTGGGTGCTGG - Intronic
1089616209 11:119696340-119696362 GCTGAAGTCTAGCTGGGGGTAGG - Intronic
1090225747 11:125071235-125071257 GCTGCAGTCCTGCTTAGAGGGGG - Intronic
1090416168 11:126541993-126542015 GCTGCAGGGCTGCCGAGGGCAGG - Intronic
1091361803 11:134983793-134983815 GCTCCTGTCCCGCTGGGGGCAGG + Intergenic
1091718350 12:2795361-2795383 GCGGCCGTCCCGCCGGGGGCCGG + Intronic
1091812184 12:3409018-3409040 GCTGCAGTGGTGCTGGGTTCTGG + Intronic
1091852778 12:3713621-3713643 GCTGGAGCTCTGCTGGGGGCAGG - Intronic
1093493111 12:19726545-19726567 GCTGCAGCCATGCCTGGGGCGGG + Intergenic
1093687176 12:22070340-22070362 GTTGCTGTCATGCAGGGGGCAGG + Intronic
1094759980 12:33521143-33521165 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1095944149 12:47744617-47744639 ACTGCATCCCTGCTGTGGGCTGG - Intronic
1096298115 12:50401158-50401180 GCTGCAGGCCTGCTCGGCCCAGG - Intronic
1096570937 12:52522783-52522805 GCTGCAGTGGTGCTGGTGCCTGG - Intergenic
1096573443 12:52538209-52538231 GTGGCAGCCCTGCTGGAGGCTGG + Intergenic
1097186609 12:57199638-57199660 CCTGCCTTCCTTCTGGGGGCTGG - Intronic
1097275157 12:57808126-57808148 ATGGCTGTCCTGCTGGGGGCAGG - Intronic
1101560122 12:105849095-105849117 ACTGCAGTCCTGCAGGTGACAGG - Intergenic
1102008946 12:109606403-109606425 GCAGCAGGCCTGCGGGTGGCGGG + Intergenic
1102147005 12:110661654-110661676 GTGACAGGCCTGCTGGGGGCAGG - Intronic
1102472709 12:113168523-113168545 CCTGCAGTCCTGCTGGTTCCCGG - Intronic
1102599182 12:114016133-114016155 GCAGCAGGCCTGCTGAGAGCTGG + Intergenic
1103705001 12:122866679-122866701 ACTGCAGCCCTGGTGAGGGCGGG - Exonic
1104643780 12:130483491-130483513 GCTGCAGTCCTGCTGGGGGCTGG + Intronic
1104789388 12:131472382-131472404 GCTGCAGTCCCCATGGGGGAAGG - Intergenic
1104931868 12:132343948-132343970 GGTGCTGTCCTGCAGGAGGCGGG + Intergenic
1104943311 12:132404819-132404841 CCTGCAGAGCTGCTGGGAGCAGG - Intergenic
1105587665 13:21759922-21759944 GCTGAAGTCCTGGTGTTGGCAGG - Intergenic
1105805733 13:23950804-23950826 GGCTCAGTCCTCCTGGGGGCTGG - Intergenic
1106800697 13:33253558-33253580 GCTGCAGCACTGCTGGGTGAGGG + Intronic
1108249706 13:48551865-48551887 GCTGCAGTCTTGCATGGAGCTGG + Intergenic
1109622111 13:64924718-64924740 GCTGCAGTCTTGCAGAGAGCTGG - Intergenic
1112941657 13:104869976-104869998 GCTGCAGAGCTGCTGTGAGCAGG - Intergenic
1113587563 13:111475719-111475741 CTAGCTGTCCTGCTGGGGGCTGG + Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114065123 14:19053798-19053820 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1114097140 14:19346204-19346226 TCTGCACTGCTGTTGGGGGCAGG - Intergenic
1114394908 14:22349341-22349363 GCTGCAGTGAGGCTGGGGGAGGG + Intergenic
1114742934 14:25116729-25116751 GCTGCAGTTCTGCCTGGAGCAGG - Intergenic
1114762355 14:25330260-25330282 GCTGCCTTTCTGCTGGGGGTAGG - Intergenic
1114981297 14:28168388-28168410 GCTGCAGCCTGGCTGGGGGATGG + Intergenic
1115028957 14:28772772-28772794 GCTGAAGTGGTGTTGGGGGCAGG - Exonic
1115984611 14:39090994-39091016 GCAGCAGTGGTGGTGGGGGCAGG - Intronic
1117531232 14:56662393-56662415 GCCGCAGTTCTGTTGGTGGCCGG - Intronic
1118786047 14:69046070-69046092 GCTGGAGTCATGCTGGGTGAGGG + Intergenic
1120256977 14:82132877-82132899 CATGCAGTGATGCTGGGGGCGGG + Intergenic
1121081702 14:91113987-91114009 GCTGCAGAGCTGCTGGCAGCTGG - Intronic
1121098173 14:91232495-91232517 GCTGCAGTCCTTATGGGGTAAGG - Intergenic
1121352603 14:93185166-93185188 GCTGCAGCGCGGCAGGGGGCGGG + Exonic
1121761149 14:96446164-96446186 ACTGGGGTCCTGCTGGGGGCCGG + Intronic
1121824542 14:96999850-96999872 GCTGCAGTCTTGCAGAGAGCTGG - Intergenic
1122082573 14:99275382-99275404 GCTGCAGACCTACTGTGTGCTGG + Intergenic
1122134730 14:99626355-99626377 GCTGGAATCCTGATGGGAGCAGG - Intergenic
1122206605 14:100150840-100150862 GCTGCTGTCCTTCTGTGTGCAGG - Intronic
1122235874 14:100330413-100330435 GGTGCAAAGCTGCTGGGGGCAGG - Intergenic
1122269537 14:100562378-100562400 GCTGCACACCTGCTTCGGGCAGG - Intronic
1122346238 14:101062278-101062300 GCTTCATTCATGATGGGGGCGGG + Intergenic
1122429069 14:101628615-101628637 GCTGCGGTCCCGCTCGCGGCCGG - Intergenic
1122899403 14:104776042-104776064 GGCGGAGTCCTGCTGGGGGTTGG - Intronic
1122899409 14:104776060-104776082 GGCGGAGTCCTGCTGGGGGGCGG - Intronic
1123039119 14:105483206-105483228 GGTGCAGCCCCGCTGGGGGCAGG + Intergenic
1123440298 15:20286056-20286078 GCTGTACTCCTGCTAGGGGTTGG + Intergenic
1125525048 15:40369311-40369333 GCTGCAGCCCTGTTTGCGGCAGG + Exonic
1125757232 15:42071991-42072013 GGCTCAGGCCTGCTGGGGGCAGG - Intronic
1126178795 15:45764936-45764958 GCTGCAGTTGTTCTTGGGGCTGG + Intergenic
1126663209 15:51052281-51052303 ACTGCAGTGCTGTTGGGGGTGGG + Intergenic
1126990746 15:54373527-54373549 GCTGCAGCCTTGCAGGGAGCTGG - Intronic
1127304589 15:57692456-57692478 GCTGCAGTGTTGCTAGGAGCTGG - Intronic
1127761099 15:62139878-62139900 GCTGCAGTCAAGATGTGGGCAGG + Intergenic
1128944657 15:71812219-71812241 GCTGCAGCCCTGCTGTGACCCGG - Intronic
1129322218 15:74781834-74781856 GCTGCAGAAGCGCTGGGGGCCGG - Intergenic
1129776630 15:78241211-78241233 GCCGGAGGCCTTCTGGGGGCAGG - Intronic
1129799739 15:78405340-78405362 GCTGCAGTGGTGGTGGGGGTTGG - Intergenic
1130652271 15:85768809-85768831 GCTGAACTCCTTCCGGGGGCTGG + Exonic
1131080042 15:89527091-89527113 GCTGCTGTCCTGCCCAGGGCAGG - Intergenic
1132566323 16:625227-625249 GCTGCAGTCCTGCCAGGTGAGGG + Intronic
1132632344 16:924930-924952 GATGCAGACCTGCTAGGGGGTGG + Intronic
1132641920 16:981942-981964 GCTGCAGGGCGGCTGGGAGCGGG - Exonic
1132659101 16:1053681-1053703 GCTGCTGTCTTGCTGAGTGCAGG + Intergenic
1132663699 16:1072504-1072526 CCTGGACTCCTGCTGGCGGCAGG + Intergenic
1132831803 16:1932149-1932171 GCTGGAGGCCTGCTGGCGCCTGG - Intergenic
1132947771 16:2541511-2541533 GCTGCAGTTCTGTGTGGGGCAGG + Intronic
1132966668 16:2659826-2659848 GCTGCAGTTCTGTGTGGGGCAGG - Intergenic
1133062086 16:3181688-3181710 GCCCCAGTCCTGGTGGGCGCTGG + Intergenic
1133063533 16:3190315-3190337 GCCCCAGTCCTGGTGGGCGCTGG - Intergenic
1133292988 16:4734873-4734895 GTGGCAGGCCGGCTGGGGGCGGG + Intronic
1133528649 16:6631792-6631814 GCAGCAGCTCTGCAGGGGGCGGG + Intronic
1133765098 16:8832454-8832476 CCCGTGGTCCTGCTGGGGGCTGG - Intronic
1133938939 16:10292414-10292436 GCAGCAGTGAGGCTGGGGGCGGG - Intergenic
1134548125 16:15125800-15125822 GCTGTCGTCCTGCAGGTGGCTGG - Intronic
1135897334 16:26419643-26419665 GCTGCAGCCCAGCAGGGGGAAGG + Intergenic
1136006936 16:27337185-27337207 GGTGGAGCCCTGCTGGGGGGAGG + Intronic
1136418319 16:30116856-30116878 GCAGCAGTGGGGCTGGGGGCAGG - Intronic
1136778037 16:32881996-32882018 TCTGCTGGCCTGCTGGGTGCTGG - Intergenic
1136892584 16:33979518-33979540 TCTGCTGGCCTGCTGGGTGCTGG + Intergenic
1137454739 16:48609795-48609817 GCTGCAGCTCTGCGGGGCGCAGG - Exonic
1137487389 16:48903029-48903051 TCTGCAGTCCTCCTGGGGTGAGG + Intergenic
1137497820 16:48984289-48984311 CCTGCAGACCTGCTGGTGGAAGG + Intergenic
1137655408 16:50154149-50154171 GCTGCAGCCCAGCGGAGGGCGGG + Exonic
1138358745 16:56408029-56408051 GCTGCTTTCCTGCTGTGGACTGG - Exonic
1138525892 16:57607059-57607081 GCTGGGTTCCTGCTGAGGGCTGG + Intergenic
1138651508 16:58463884-58463906 GCTGGGGTCGTGCTCGGGGCTGG - Intronic
1139849622 16:69942842-69942864 GCTGCTCTCCTGCTAGGGGACGG + Intergenic
1139949736 16:70663137-70663159 GCTGGATGTCTGCTGGGGGCTGG - Exonic
1141158478 16:81612981-81613003 GCTGCGTTCCAGCTGGGGGAAGG - Intronic
1141697190 16:85625691-85625713 GCTGCAGTCCTGCTGTGAATGGG - Intronic
1142151012 16:88512557-88512579 TCTGCTCTCCTGCTGGGGCCTGG - Intronic
1142192908 16:88726051-88726073 GCTGCAGTGCTGACGGTGGCTGG - Intronic
1142217856 16:88838584-88838606 CCTGCAGGGCTGCTGTGGGCCGG - Intronic
1142230722 16:88899074-88899096 GCTGCGGTGCTGCTGTGGGGTGG - Intronic
1203080456 16_KI270728v1_random:1144105-1144127 TCTGCTGGCCTGCTGGGTGCTGG - Intergenic
1142470865 17:162574-162596 GCTGCATTCCTTCTGGAGCCCGG - Intronic
1142979790 17:3664900-3664922 GCTGGATTCCTGCAGGGGCCTGG - Intronic
1143543268 17:7582019-7582041 GCTGCTCTCCTGCTGGGGGGGGG - Exonic
1144337326 17:14283171-14283193 TCTGCAGTACTGCTGGGGATGGG - Intergenic
1144642163 17:16943625-16943647 GCTGATGTCCTGCTGGGGGCAGG - Intronic
1145206985 17:20989834-20989856 GCCGATGTCCTGCTGGGGGGAGG + Intergenic
1146913817 17:36665344-36665366 GCTGAAGGCCAGCTGAGGGCAGG - Intergenic
1147162700 17:38577360-38577382 TCTGAAGTCCTTCTGGGAGCAGG - Intronic
1147167394 17:38600853-38600875 GTTCCAGCCATGCTGGGGGCAGG - Intronic
1147371815 17:39997686-39997708 GCTGCATTCGTGCAGGGGGTGGG + Exonic
1147614906 17:41822043-41822065 GCTGGGGTCCTGGTGGGGGCTGG - Intronic
1147625614 17:41897814-41897836 GATGCTGTCCTGCTGGGGGCTGG + Exonic
1147653953 17:42077968-42077990 GGTGCCGTCCTCCTTGGGGCAGG - Intergenic
1147944870 17:44075230-44075252 GCTGCACTGCAGCTGGGGGTCGG + Intronic
1148047350 17:44752290-44752312 ACAGCACTCCTGCTGGTGGCAGG - Intergenic
1148085930 17:44993850-44993872 CCTGCAGTGCTGGTGGGAGCTGG - Intergenic
1148157575 17:45432515-45432537 GCTGCCCTCCATCTGGGGGCTGG - Intronic
1149576166 17:57715248-57715270 GCTGCAAGCCTGCTGGGGCTGGG + Intergenic
1149992472 17:61390615-61390637 GCTGCAGGCCTGCAGGGAGTCGG + Intronic
1150275289 17:63894166-63894188 CCTGCAGTCCTGATGGTGACAGG + Intergenic
1150277420 17:63908854-63908876 CCTGCAGTCCTGATGGTGACAGG + Intergenic
1150336627 17:64335016-64335038 GCTGCCGTCACGCTGGGGCCCGG - Intronic
1150618732 17:66792667-66792689 TCTGCAGTACAGCTGTGGGCTGG + Intronic
1151188137 17:72378880-72378902 GGAGGACTCCTGCTGGGGGCCGG + Intergenic
1151415355 17:73958595-73958617 GCTGCTTTGCTGCTGGGGGTGGG + Intergenic
1151579825 17:74971739-74971761 GAAGCAGTCTTGCTGGGGCCAGG + Intronic
1151891994 17:76956491-76956513 CCTACAGTCCTGCTGGGACCTGG - Intergenic
1152361575 17:79835469-79835491 GCTGCGGACCTGGTGGGGGCTGG - Intronic
1152462292 17:80447892-80447914 GCTGAAATCCTTCTGGGGACAGG - Intergenic
1152465596 17:80464451-80464473 CCTGCAGTCCTGCGTGGGGGCGG + Intergenic
1152696604 17:81800786-81800808 GCTGCAGCGGGGCTGGGGGCAGG - Intergenic
1152768506 17:82153734-82153756 GCTGCTGCCCTGCTGGGGGTGGG - Intronic
1153689946 18:7582310-7582332 GCTGCTGTCCTTCTGTAGGCTGG + Intronic
1153926068 18:9836127-9836149 GCTGCTGTGCTGCTCGTGGCCGG + Intronic
1153950095 18:10051335-10051357 ATTGCAGTCCTGCTGTGTGCCGG + Intergenic
1154011701 18:10580044-10580066 CCTGCTGTCATGCTGGAGGCTGG - Intergenic
1154199629 18:12290271-12290293 GATGCAACCCTGCAGGGGGCAGG - Intergenic
1154493513 18:14939278-14939300 GCTCCTGTCCCTCTGGGGGCAGG - Intergenic
1155390014 18:25325471-25325493 CCTGCAGTGGTGCTGGGGGCAGG - Intronic
1155519781 18:26656724-26656746 GCTGCGCTCCTGCCGGGGGTAGG - Intronic
1156421633 18:36960237-36960259 GCTGCAGCCCGGCAGGGGGAGGG + Intronic
1156457192 18:37301458-37301480 GTAGCTGTCCTGCTGGGGGAGGG - Intronic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1158377203 18:56884613-56884635 GCTGCAGCCGTGGTGGGGGATGG - Intronic
1159878507 18:73835465-73835487 TCTGCAGTCCTGCAGGGGTTGGG - Intergenic
1159951064 18:74484063-74484085 GTTGCAGTTTTGCTGGGGTCAGG + Intergenic
1160028859 18:75241417-75241439 GCTGCATCGCTGATGGGGGCAGG + Intronic
1160715047 19:572725-572747 GGTGCGGTCCTGCAGGGGCCGGG + Intronic
1160980809 19:1815779-1815801 GCTGCGGGCCGGGTGGGGGCGGG + Exonic
1160993642 19:1871968-1871990 CCTGCAGTCCTGCTGAGGAGGGG - Intergenic
1161223898 19:3133418-3133440 GCTGCTATCCGGTTGGGGGCGGG + Intergenic
1161272421 19:3397436-3397458 GCTGCAGCCAGGCTGGGGGCTGG + Intronic
1161301793 19:3546316-3546338 GCGGCTGTGCTGCTGGGTGCTGG - Exonic
1161495809 19:4584982-4585004 GCTGCCGTTCTGGGGGGGGCCGG - Intergenic
1162063433 19:8110717-8110739 CCTGCAGTCTTGCTGGGGGGTGG - Intronic
1162359192 19:10207368-10207390 TCTGCAGGTCTGATGGGGGCTGG - Intronic
1162568448 19:11457228-11457250 GCTGCAGGCCTGTTGGGTGGGGG - Intronic
1162785182 19:13030363-13030385 GCTGCCGTCCTGCTATGTGCCGG - Intronic
1162798097 19:13096811-13096833 GCTGCAGGCCAGCTGGGCCCGGG + Intronic
1162801059 19:13110664-13110686 GCTGTAGAACTGCTGGGGCCTGG + Intronic
1162807279 19:13144535-13144557 GGGTCAGTCCTGGTGGGGGCAGG - Intronic
1162818773 19:13210577-13210599 GCCGGAGCCCTGCTGGGCGCTGG + Intronic
1162936674 19:13984751-13984773 CCTTCAGTCCTGCCGGGGGTCGG - Intronic
1163508964 19:17724219-17724241 GCTGACGTCCTGGAGGGGGCGGG + Intronic
1163664119 19:18595104-18595126 TCCGCCGGCCTGCTGGGGGCTGG - Intronic
1163701840 19:18790106-18790128 GCTGCATCCCTGCGGGGGGGAGG + Exonic
1163747480 19:19056928-19056950 CCTGCTGTCCTGCTGGTGGTGGG + Intronic
1164656088 19:29923050-29923072 GCTGGAGTGCTGCTGGAGGTTGG - Intergenic
1164866132 19:31605876-31605898 GCTGGAGTCCTAGTGGGGGATGG + Intergenic
1165346971 19:35254573-35254595 GCTGCAGTGCAGCTGGAGGTGGG - Intronic
1165353347 19:35289242-35289264 GCTGCAGTCCTGTGGAGGACTGG + Intergenic
1165799981 19:38543518-38543540 GATGGATTCCTGGTGGGGGCGGG - Exonic
1165862864 19:38918314-38918336 GCTGCTGAGCTGCTCGGGGCAGG + Intronic
1167508167 19:49882037-49882059 GCGGGAGTCCTGCGGGGAGCTGG - Exonic
1168021280 19:53610587-53610609 GCTGGAGCTCTGCCGGGGGCAGG + Intergenic
1168110745 19:54190213-54190235 GCTTCGGTCCTGCGAGGGGCGGG + Intronic
1168654616 19:58118170-58118192 GCGGCAGCCCTGCTCTGGGCAGG - Intronic
925741896 2:7012662-7012684 GCTGCAGCCCTGCTGGAGGCTGG + Intronic
925785846 2:7430963-7430985 GCTGCAGGCCTGCGAGTGGCAGG + Intergenic
926682420 2:15674090-15674112 GCTGCAGCCCCGCTGGGAGCAGG + Intergenic
926707310 2:15845940-15845962 GCTGCAGGCCTGAGGGGGTCTGG - Intergenic
927982650 2:27384084-27384106 GCTGCATTCCTGCCAGGGGGAGG + Exonic
929592852 2:43158261-43158283 GGAGCAGTGCTGCAGGGGGCAGG - Intergenic
929795487 2:45055572-45055594 GTTACAATCCTGCTGGGGTCTGG - Intergenic
931840622 2:66144530-66144552 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
932323956 2:70842598-70842620 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
932327312 2:70871719-70871741 GCTGCAGCACTACTGGAGGCGGG + Intergenic
932377552 2:71251138-71251160 GCTGCAGCCTGGCGGGGGGCAGG - Intergenic
932421780 2:71605576-71605598 GCTGCTCTCCTGCTGGGGCAGGG + Intronic
932467830 2:71934907-71934929 ACAGGACTCCTGCTGGGGGCAGG - Intergenic
933241603 2:79927826-79927848 GTTGCAGTTCTGCTGAGGCCTGG + Intronic
934110643 2:88739071-88739093 GCTGGAGTCCTGGTTGAGGCTGG + Intronic
934618305 2:95789042-95789064 GCTGGTCTCCTGCTGGGTGCTGG + Intergenic
934642588 2:96035517-96035539 GCTGGTCTCCTGCTGGGTGCTGG - Intronic
935617719 2:105103060-105103082 GCTGCAGGAGAGCTGGGGGCGGG + Intergenic
936785952 2:116094518-116094540 GCAGCAGTCCTGCTGCTGGGAGG + Intergenic
937124082 2:119462147-119462169 GCTGCAGGCCTGATGGAGGAAGG - Intronic
937907357 2:127058770-127058792 GCTGCAGTGGGGGTGGGGGCTGG + Intronic
938391681 2:130911769-130911791 GCTGGCGTCTTGCTGGGGGGAGG - Intronic
938448413 2:131394761-131394783 GCTGAGCTCCAGCTGGGGGCGGG + Intergenic
938482377 2:131672801-131672823 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
938811317 2:134855524-134855546 GCAGCAGTCGTGGTGGAGGCAGG - Intronic
938848091 2:135232225-135232247 GCTGCAGTGAGGCTGGGGGAGGG + Intronic
939305135 2:140401487-140401509 GCTGCAGCCCTTTTGGGGGTTGG - Intronic
943233617 2:185290247-185290269 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
943266532 2:185739032-185739054 GCCGCAGGCCTGCTGGGGAGCGG + Intronic
943426897 2:187749261-187749283 GCTGCAGCCTTGCAGGGAGCTGG - Intergenic
945710082 2:213284444-213284466 GCTGTGGGCCTGCTGGGGGTGGG + Exonic
946386733 2:219388137-219388159 GGTGCAGCCCTGCGAGGGGCAGG - Intronic
947119434 2:226799884-226799906 GCTGCAGCACGGCTGGGGGGCGG - Intergenic
947235650 2:227938159-227938181 GCTGAAGCCCTGCTGGGTGATGG + Intergenic
947290505 2:228568677-228568699 GCTGCAGTGAGGCTGGGGGAGGG + Intergenic
947750725 2:232530640-232530662 CCTCAAGTCCTGCCGGGGGCAGG - Intronic
947824149 2:233092867-233092889 GCTGTAGGGGTGCTGGGGGCTGG - Intronic
948302080 2:236915027-236915049 GCTGCAGTCCTGCCCTGGGTAGG - Intergenic
948371900 2:237494980-237495002 GCTACATTCCAGCTGGAGGCTGG + Intronic
948536708 2:238652273-238652295 GCTGCAGCCCTGTGGGGGCCGGG + Intergenic
948593232 2:239064325-239064347 GCAGCAGCCCTGCTGGGGGCGGG + Intronic
949044546 2:241866508-241866530 CCCGCAGTCCTGCTGGGGCTGGG - Intergenic
1169239791 20:3966872-3966894 GCCTTAGTGCTGCTGGGGGCTGG + Intronic
1170078704 20:12448704-12448726 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
1170090292 20:12582924-12582946 GCTGCAGTGAGGCTGGGGGAGGG + Intergenic
1170135973 20:13074051-13074073 GTTGGAGGCCTGCTGTGGGCTGG + Intronic
1170458484 20:16554849-16554871 GCTGCAGCCTTGCAGGGAGCTGG + Intronic
1170794988 20:19539351-19539373 GCTGGATTTCAGCTGGGGGCAGG + Intronic
1171458799 20:25286977-25286999 GCTGCATTCCTCCTGGAGCCTGG + Intronic
1172109473 20:32536780-32536802 GCTGCAGCCCGGCTGGGAGTGGG + Intronic
1172208020 20:33178255-33178277 GATCCAGGCCTGGTGGGGGCAGG + Intronic
1173190212 20:40870185-40870207 GCTGCAGTTCTGCTTGGCTCAGG - Intergenic
1173578469 20:44129174-44129196 GCTTCACTCCAGCTGGAGGCTGG - Intronic
1173601417 20:44298130-44298152 ACTGTAGACCTGCTGAGGGCAGG + Intergenic
1173642730 20:44615195-44615217 GGGGCAGTCCTGCTGTAGGCCGG + Intronic
1173906279 20:46632002-46632024 GCTGCAGCCCAGCAGGGAGCTGG - Intronic
1173966404 20:47115889-47115911 GCTGCAGCAGTGCTGGGGGTGGG - Intronic
1174451641 20:50624389-50624411 GGTGCACACCTGTTGGGGGCTGG - Intronic
1175228334 20:57458374-57458396 GCTGCAGTCAAGGTGGTGGCTGG + Intergenic
1175608233 20:60328840-60328862 ACTGCATTCCTGCTGAGGACTGG - Intergenic
1175863571 20:62163021-62163043 GCTGCCCTCCTGCTGGGTGCTGG + Intronic
1175909629 20:62398591-62398613 GCCGGGGTCCTGCTGGGGGAAGG - Intronic
1176031710 20:63016047-63016069 GCTGCAGGCCTGGGCGGGGCGGG - Intergenic
1176118460 20:63443626-63443648 GCTGCAGTGCTCCTGGAGGCAGG - Intronic
1176121872 20:63457725-63457747 GCTGCAGCAATGCAGGGGGCTGG - Intronic
1176218958 20:63961054-63961076 GCAGCAGGGCTGCTGGGGGCTGG + Intronic
1176515538 21:7780787-7780809 GCTGACACCCTGCTGGGGGCAGG - Intergenic
1176671436 21:9738652-9738674 GCTGCAGTCTTCCTAGGGGAAGG + Intergenic
1178649566 21:34410799-34410821 GCTGACACCCTGCTGGGGGCAGG - Intergenic
1179479121 21:41666619-41666641 GCTGCACTGCAGCTGAGGGCTGG + Intergenic
1179494398 21:41762506-41762528 GCTCCAGCCCTTCTGGGGTCGGG + Intronic
1179908004 21:44434149-44434171 GCTGCAGCTCTGATGGGGTCTGG + Intronic
1180124217 21:45778247-45778269 GCTGAAGTTGTGCTGGGGACTGG + Intronic
1180143835 21:45908985-45909007 GCTGGAGACTAGCTGGGGGCTGG - Intronic
1180483613 22:15776418-15776440 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1180802293 22:18637554-18637576 GCTGCACATCAGCTGGGGGCGGG - Intergenic
1180838080 22:18941758-18941780 GCTGCACTGCTGCTTGTGGCAGG - Intergenic
1180858608 22:19063994-19064016 GCTGCAGGCCTGAGGTGGGCTGG - Intronic
1180975926 22:19848400-19848422 GCTGCTTTCCTGCTGGGGGAAGG - Exonic
1181029845 22:20144399-20144421 GCTGCACACCTGCTGGGGCCAGG + Intronic
1181166530 22:20986800-20986822 GCTGCACTGCTGCTGAGAGCAGG + Intronic
1181169432 22:21000017-21000039 GCTGCAGGCCTGCAAGCGGCGGG - Exonic
1181219433 22:21357707-21357729 GCTGCACATCAGCTGGGGGCGGG + Intergenic
1181513426 22:23398920-23398942 GCTGCACACCTGCTGGGGCCAGG - Intergenic
1181701315 22:24623017-24623039 GCAGCAGTGGTGTTGGGGGCAGG - Intronic
1182057776 22:27373454-27373476 GCAGCAGCCTTGCTGGGGGAGGG + Intergenic
1183034811 22:35133626-35133648 TCTGCAGTCGAGTTGGGGGCAGG + Intergenic
1183293026 22:37014485-37014507 GGGGCATGCCTGCTGGGGGCAGG - Intronic
1183441549 22:37825661-37825683 GGGGCTGCCCTGCTGGGGGCGGG - Intergenic
1183731144 22:39619255-39619277 GCTGGAGGCCAGCTGGGGCCAGG - Intronic
1184096152 22:42317629-42317651 CCTGCATTCCCGCTGGGGGCTGG + Intronic
1184458681 22:44625288-44625310 GCTGCAGTAGGTCTGGGGGCTGG + Intergenic
1184752055 22:46492143-46492165 CCTGCAGACCTGCTGGAGCCTGG - Intronic
1184769591 22:46589514-46589536 TCTGAAGACCTGCTGGGGCCAGG + Intronic
1185004546 22:48268035-48268057 TTTGCTGTCCTGCTGGTGGCAGG - Intergenic
1185254491 22:49824883-49824905 GCAGCATTCCTGCTGGGGCCAGG + Intronic
1185285167 22:49996813-49996835 GTTGCAGAGCTGCTGGGGGACGG + Exonic
949189572 3:1235846-1235868 GACTCAGTGCTGCTGGGGGCGGG + Intronic
949804011 3:7934589-7934611 GCTGCAGTCTGGCTGGGGGAGGG + Intergenic
950124822 3:10504806-10504828 GCAGCAGTCATGCTGGGTGGTGG - Intronic
950421602 3:12902909-12902931 CCTGCACCCCTGCTGGGAGCAGG + Intronic
950440080 3:13005411-13005433 ACTGCTGGTCTGCTGGGGGCAGG - Intronic
950570219 3:13795230-13795252 GCTGAAGTCATGGTGTGGGCAGG - Intergenic
950602347 3:14045865-14045887 GTTGAAGTCTTCCTGGGGGCGGG + Intronic
952408654 3:33027221-33027243 GCTGCAGCCTTGCAGAGGGCTGG + Intronic
952968662 3:38637035-38637057 GCAGCTGTCCTGGTGGGGGGTGG - Intronic
953254673 3:41278222-41278244 GCTGCAGCCCGGTTGGGGGAGGG + Intronic
953260240 3:41331204-41331226 GCAGATGTCCAGCTGGGGGCAGG + Intronic
953411009 3:42690531-42690553 GCTGGGGGCCTGCTAGGGGCTGG + Intronic
955412084 3:58662169-58662191 GCAGCAGGCCTGCAGGGGCCAGG - Intronic
958769247 3:98406993-98407015 GCTGCAGTGAGGCTGGGGGAGGG + Intergenic
959059765 3:101605522-101605544 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
960011030 3:112834846-112834868 GCTGCAGCCTTGCAGGGAGCTGG - Intronic
960140061 3:114142958-114142980 GGGCCAGGCCTGCTGGGGGCTGG - Intronic
960471780 3:118075178-118075200 CCTCCAGACCTGCTTGGGGCTGG - Intergenic
960577028 3:119240386-119240408 GCCCCAGTCCTGCGAGGGGCCGG - Exonic
961047976 3:123722339-123722361 GCAGCAGCCCTGCTGAGGACAGG - Intronic
961269982 3:125681225-125681247 GCAGCAGCCCTGCTGAGGACAGG + Intergenic
961297052 3:125893378-125893400 GCTGCACTGCTGCTTGTGGCGGG - Intergenic
961367672 3:126410951-126410973 GCTGCCTTCCTCCTGGAGGCTGG + Intronic
961476597 3:127150701-127150723 GCTGCTATCCTGCTGGGAGCCGG - Intergenic
961771751 3:129255091-129255113 GCTGGAGCCCTGCTGGGGGTGGG + Intronic
961928087 3:130504420-130504442 GTTGTAGATCTGCTGGGGGCTGG - Intergenic
962362029 3:134750589-134750611 GCTGCAGTTCTGCTAGTGTCAGG - Intronic
962554082 3:136528290-136528312 GCTGCAGTAAGGCTGGGGGAGGG - Intronic
963250310 3:143096459-143096481 GCTGTAGCCCTGCAGGGAGCCGG + Intergenic
963664414 3:148164689-148164711 GGAGCCTTCCTGCTGGGGGCGGG + Intergenic
964801764 3:160565466-160565488 GCTGCAGTCGCGCTGGGGTTAGG - Exonic
966372886 3:179266820-179266842 GCTGCAGCTGCGCTGGGGGCTGG - Intronic
966879717 3:184343273-184343295 GCTGCAGCCCTGCGAGGTGCTGG - Intronic
967054748 3:185822823-185822845 GCTGCTATTCTGCTGGGGGTAGG + Intronic
967627572 3:191703585-191703607 GCTGCAGCCCTGCTGCTGGTGGG - Intergenic
968468398 4:764637-764659 GCTGCAGGCCAGATAGGGGCGGG + Intronic
968606438 4:1537871-1537893 GCTGTCCTGCTGCTGGGGGCAGG + Intergenic
968693714 4:2009677-2009699 GCTCCAGCCCGACTGGGGGCCGG - Exonic
968814617 4:2815443-2815465 GCTGCTGTCCCGCTGTGGGCAGG - Intronic
968963880 4:3759691-3759713 GATGCAGTGCTTCTGGGAGCTGG - Intergenic
969167388 4:5328909-5328931 TCTGAAGTCCAGCTGGTGGCCGG + Intronic
969462370 4:7335580-7335602 GCTGCAGTCTTGCTGGAGGCGGG + Intronic
969625855 4:8305285-8305307 ACTGCAGGCCTGCTGCGGGCAGG - Intronic
969670197 4:8585934-8585956 GCTGCAGTCCTTCTGAGTGGGGG + Intronic
969689372 4:8695864-8695886 GCTGCAGCCCTGGGGCGGGCAGG + Intergenic
970407693 4:15778949-15778971 GCTGCAGCCCGGCGAGGGGCTGG - Intronic
970545557 4:17126756-17126778 GCTACAGTCCTGCTGGCTCCAGG + Intergenic
971376742 4:26061819-26061841 GCTGGAGCCCTGCTGAGGCCAGG + Intergenic
972553811 4:40160993-40161015 CTTGCAGTCCTTCTGGGGGTGGG - Intergenic
976136082 4:81937486-81937508 GCTGCAGTGAGGCTGGGGGAGGG - Intronic
976477935 4:85506459-85506481 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
977471777 4:97452133-97452155 GCTGCAGCTGTGCTGGGGGCGGG - Intronic
979927213 4:126582740-126582762 GCTGCAATCCTAGTGGGTGCTGG - Intergenic
980493413 4:133560281-133560303 GCTGCAGCCTTGCAGGGAGCTGG - Intergenic
980593995 4:134928780-134928802 GCTGCAGCCTGGCTGGGGGAAGG - Intergenic
981772244 4:148323466-148323488 GCTGCAGCCAGGCTGGGGGAGGG - Intronic
982207330 4:153006427-153006449 GCTGCAGCCGTTCTGTGGGCCGG + Intergenic
983215510 4:164998754-164998776 GCTGCACTGCTGCTTGTGGCAGG - Intergenic
985371145 4:189285792-189285814 GCAGCTTTCCTGCTGGGTGCTGG + Intergenic
985403300 4:189613167-189613189 GCTGCAGTCTTCCTAGGGGAAGG - Intergenic
985535726 5:464873-464895 GCGTCTGTCCTGCTGGGGGCCGG + Intronic
985661709 5:1160530-1160552 GCGACACTGCTGCTGGGGGCTGG + Intergenic
985959266 5:3287509-3287531 GGTGCAGTGCTGGTGGGGGAAGG - Intergenic
986128707 5:4907751-4907773 GCTGCAGCTCTGCAGGTGGCAGG - Intergenic
987062861 5:14258901-14258923 GCTGCAGTCCTGCTGGGTGGTGG + Intronic
988220103 5:28333699-28333721 CCTACAGTTCTGCTGAGGGCAGG + Intergenic
988381271 5:30499558-30499580 GCTGCAGTCTAGCTGGGGGAGGG - Intergenic
989660469 5:43792057-43792079 GCGGCAGTGAGGCTGGGGGCGGG + Intergenic
990986045 5:61641959-61641981 GCTGCAGCAGTGCTGGTGGCAGG + Intronic
992343795 5:75854919-75854941 CTTGCAATCCAGCTGGGGGCTGG - Intergenic
993151976 5:84173486-84173508 GCTGCTGTCTTCCAGGGGGCGGG - Intronic
993450637 5:88069284-88069306 ACTGCATCCCTGGTGGGGGCAGG - Intergenic
993580550 5:89654610-89654632 GTAGCAGTCCTGCTTGGGGAAGG - Intergenic
993840690 5:92875584-92875606 GGTGCAGTTTTGCTGGGGGTAGG + Intergenic
993900213 5:93579765-93579787 GCTGCCAGCCGGCTGGGGGCGGG - Intergenic
996324533 5:122258209-122258231 GCTCCTGTCCTGATGGGGGATGG + Intergenic
996360115 5:122636493-122636515 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
997588926 5:135061198-135061220 ACTGCACTCCTGGTGGGGGAGGG + Intronic
998358789 5:141566133-141566155 GCTGGAGGCCTGTTGGGGTCAGG + Intronic
998926292 5:147130156-147130178 GCTGAAGTTGTGCTGGGGACTGG + Intergenic
999300801 5:150489100-150489122 GGTGCAGTCCTGCTGGATTCAGG + Intronic
999653910 5:153794469-153794491 CCTGCAGTGATGTTGGGGGCAGG + Intronic
1001980731 5:176035622-176035644 GCTGCAGTGCTTGTGGGGGAAGG - Intergenic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1002236729 5:177808443-177808465 GCTGCAGTGCTTGTGGGGGAAGG + Intergenic
1003494771 6:6654149-6654171 GGTGCAGTGCTGCTATGGGCTGG - Intronic
1003647512 6:7926096-7926118 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1004463565 6:15862125-15862147 AGTGCAGTCCTGCTTGGGTCTGG - Intergenic
1004792418 6:19041685-19041707 ACTGCAGTCTTGCTGGGTGTAGG - Intergenic
1004998649 6:21218486-21218508 GCTGCAGTCAGGCTGGCAGCCGG + Intronic
1005775951 6:29130747-29130769 GCTGCAGCCTTGCAGGGAGCTGG + Intergenic
1006183667 6:32168547-32168569 GCAGCAGGGCTGCAGGGGGCTGG + Exonic
1006248650 6:32761975-32761997 GGTGCGGTCCGGCTGGGGGCTGG - Intronic
1006670732 6:35728384-35728406 GCTGCGCTCAGGCTGGGGGCTGG - Intronic
1006749612 6:36368604-36368626 GCTGCTTTCCTGCGGGGAGCTGG - Intronic
1006798463 6:36745142-36745164 GCTGCATTCCTGGGTGGGGCAGG + Exonic
1007424918 6:41740595-41740617 GCTGGAGCCCTGCTGGCTGCAGG + Exonic
1007617285 6:43187559-43187581 GGAGGAGTCCTGCTGGGGGTTGG + Intronic
1009695312 6:67095829-67095851 GCTGCAGTGAGGCTGGGGGAGGG + Intergenic
1009846796 6:69145305-69145327 GCTGCAGCCTTGCAGGGAGCCGG - Intronic
1011414231 6:87100995-87101017 GCTGCAGTCCCACTGAGGCCTGG - Intergenic
1012982643 6:105846416-105846438 GCTGCAGTTTTGCTGGGGTAGGG - Intergenic
1013055402 6:106577880-106577902 GCTGCATTCCTCCTGGAAGCAGG - Intronic
1013578303 6:111507438-111507460 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1013624324 6:111921443-111921465 GCTGCAGTCAAGTTGGGGGTGGG + Intergenic
1013643467 6:112111683-112111705 GCTGCAGTGGTGCAGTGGGCTGG + Intronic
1015754724 6:136595978-136596000 GATGGAGTCTTGCTGGCGGCTGG - Intronic
1016112364 6:140241389-140241411 GCTACAGTCTTGCTGTTGGCTGG + Intergenic
1016200109 6:141395741-141395763 GCTGCAGTCTTGCAGAGAGCCGG + Intergenic
1017815961 6:158016918-158016940 TCTGGCGTCCAGCTGGGGGCAGG - Intronic
1018227338 6:161640955-161640977 GCTTCATTCCTGCAGGGAGCCGG - Intronic
1019018805 6:168900626-168900648 GCTGCACTCCCCCTGGGGTCAGG - Intergenic
1019437839 7:1031078-1031100 CCTGCCGACCTGCTGGGGGAGGG - Intronic
1019470122 7:1215028-1215050 GCCCCACTTCTGCTGGGGGCCGG + Intergenic
1019630470 7:2046247-2046269 GCTGCCGTCCAGCTGAGGACAGG - Intronic
1020774136 7:12432065-12432087 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1021510457 7:21427871-21427893 GCCGCCGACCTGCCGGGGGCCGG - Intergenic
1021990611 7:26137925-26137947 GCTGCAGCCTTGTTGGGGGTGGG + Intergenic
1022336056 7:29423269-29423291 TCTTCAGTCCTGCGGGGTGCAGG - Intronic
1022423653 7:30247068-30247090 ACTGCAGTGGTGCTGGTGGCAGG + Intergenic
1022490789 7:30816037-30816059 CCTGCAGCCCTGCTGGAGGTGGG - Intronic
1023015980 7:35968880-35968902 GATGCAGTCTAGCAGGGGGCCGG + Intergenic
1023872191 7:44269214-44269236 GCTGGGGGCCTGGTGGGGGCAGG + Intronic
1024268959 7:47628006-47628028 GTTGCAGTCAGGCTGTGGGCTGG - Intergenic
1025607186 7:63047777-63047799 GCCCCAGGCCTGCTGGGTGCAGG + Intergenic
1026808498 7:73443091-73443113 CCAGCAGTCCTGCTGGAGGTCGG + Intronic
1028024697 7:85822065-85822087 GCTGCAGCCCTGCAGAGAGCTGG + Intergenic
1029765980 7:102626609-102626631 GCTCCTGTCCTGCTGGGCCCAGG + Intronic
1029967012 7:104750682-104750704 GCTGCACTGCTGCTTGTGGCGGG + Intronic
1030033229 7:105388243-105388265 GCTGCACTCCCGCAGCGGGCGGG + Intronic
1030392361 7:108943244-108943266 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
1031464228 7:122088664-122088686 GCTGCAGTCAAGGTGGTGGCAGG + Intronic
1032155646 7:129465442-129465464 GCTGGAGTTCTGCCTGGGGCGGG + Intronic
1032250679 7:130254760-130254782 GCTGCAGCCAGGCTGGGGGAGGG - Intergenic
1032858515 7:135857362-135857384 GCTGCAGCCTTGCAGGGAGCCGG - Intergenic
1033356216 7:140602192-140602214 TCTGCTCTCCTGCTGGGTGCAGG + Exonic
1033677307 7:143556087-143556109 GGTGAAGTTCTGCTGGGGACTGG + Intergenic
1033694527 7:143773349-143773371 GGTGAAGTTCTGCTGGGGACTGG - Intergenic
1034252948 7:149706754-149706776 GGGGCAGTCCCGCTGAGGGCAGG - Intergenic
1034451294 7:151138573-151138595 CCTGCAGCCCTGCCTGGGGCCGG + Intronic
1034493104 7:151404854-151404876 GCTTCGGACCTGCTGGTGGCGGG + Intronic
1035160986 7:156949829-156949851 GCCGCGGTCCTGCTGGCGGTGGG + Exonic
1035221199 7:157407486-157407508 GGTGCAATCCTCCTGGAGGCAGG + Intronic
1036192740 8:6685761-6685783 TCTGCACTTCAGCTGGGGGCTGG - Intergenic
1036212343 8:6852625-6852647 GCTGCAGTCCTGCCCTGGGATGG - Intergenic
1036777745 8:11625248-11625270 GCCCCAGGCCTGCTGGGTGCAGG - Intergenic
1037832777 8:22199015-22199037 GCTCCAGTCTTGGAGGGGGCAGG + Intronic
1038362158 8:26891211-26891233 GCTGCAGACCACCTGTGGGCAGG + Intergenic
1038870589 8:31489519-31489541 GCTGCAGTGAGGCTGGGGGTGGG - Intergenic
1039669308 8:39578866-39578888 AATGCAGTCCTGGTGGGGGGAGG + Intergenic
1041181883 8:55257923-55257945 GCTGGATTCCCACTGGGGGCAGG - Intronic
1041389963 8:57339337-57339359 GGGGCAGTGCTGCTGGGGGCAGG + Intergenic
1041843017 8:62293944-62293966 GCTGCAGTGAGGCTGGGGGAGGG - Intronic
1043702748 8:83312206-83312228 GCTGCAGCCTTGCAGGGAGCTGG - Intergenic
1044588670 8:93892478-93892500 GCTACAGTCCTGCAGTGGGGAGG - Intronic
1044811799 8:96070836-96070858 GCTGCAGTGAGGCTGGGGGGAGG + Intergenic
1045054688 8:98358912-98358934 GCTGCAGTCCAGCTCAGGGGTGG - Intergenic
1047313337 8:123710604-123710626 GCTGCAGTCCTGGAGGGGGTGGG - Intronic
1047334438 8:123922265-123922287 GCTGACTGCCTGCTGGGGGCAGG + Intronic
1047411720 8:124629686-124629708 CCTCCTGTCCTGCTGGAGGCTGG + Intronic
1047928311 8:129702199-129702221 GCTTCAGTCTTGGTGGAGGCTGG - Intergenic
1048329814 8:133463908-133463930 GCTGCAGTCTCTCTGGGAGCAGG - Intronic
1049014918 8:139913581-139913603 GCAGCAGGCCTGTTGGAGGCAGG - Intronic
1049197959 8:141325787-141325809 GCTGCAGCCCTCGAGGGGGCTGG - Intergenic
1049275881 8:141719957-141719979 GCTGTACTCCTGCCTGGGGCTGG + Intergenic
1049275906 8:141720067-141720089 ACTGCACTCCTGCCTGGGGCTGG + Intergenic
1049454067 8:142678131-142678153 GGTGCAGACCTGCTGGGAGAGGG + Intronic
1049519063 8:143079073-143079095 GCAGCAGTCACGCTGGGGCCAGG + Intergenic
1049542728 8:143215779-143215801 CCTGCAGCCCTCATGGGGGCTGG + Intergenic
1049546753 8:143235629-143235651 GCTGCAGCCGTGCTGTCGGCCGG + Intergenic
1049602274 8:143513418-143513440 GCAGCAGCCTTGGTGGGGGCAGG - Intronic
1049734948 8:144199851-144199873 ACTGCAGCCAGGCTGGGGGCAGG + Intronic
1050899905 9:10934126-10934148 CCTCCACTCCTGCTGGTGGCTGG - Intergenic
1051917542 9:22226044-22226066 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
1052063781 9:23992098-23992120 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1052466691 9:28838959-28838981 GCTGCAGCCTTGCAGGGAGCTGG - Intergenic
1053411872 9:37921017-37921039 GCTGCAGCCCTGGTGAGAGCTGG - Intronic
1054342193 9:63876540-63876562 GCGCCGGCCCTGCTGGGGGCTGG - Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1056185080 9:84126403-84126425 GCTGCAGTCCAGGTGTTGGCCGG - Intergenic
1057201756 9:93144235-93144257 GCAACAGTACTGCTGGGGCCGGG - Intergenic
1057234166 9:93345778-93345800 CCTTCAGTCCTACTGTGGGCGGG - Intronic
1057716851 9:97502153-97502175 GCTGGAGTCCTGCGGGTGGCGGG - Intronic
1057953627 9:99389574-99389596 GCTGCAGTTCTGCAGGAGACAGG - Intergenic
1058286585 9:103187128-103187150 GCTGCCTCCCTGCGGGGGGCAGG + Intergenic
1060206505 9:121685544-121685566 GCTGGAGACCTGCTGAGGCCAGG - Intronic
1060222657 9:121772857-121772879 GCTGCAGCTCAGCTGGTGGCCGG + Exonic
1060878276 9:127099090-127099112 GGTCCAGTCCCGCTGTGGGCAGG - Intronic
1060885521 9:127149540-127149562 GCAGATGTCCTGCTGGGGACTGG - Intronic
1061149580 9:128821190-128821212 ACTGCAGACCTGCGGGGGGAAGG - Exonic
1061623526 9:131826757-131826779 GCTGCAGTCCTGCTGCAAGCGGG + Intergenic
1061632708 9:131883293-131883315 GCTGCTGCCCTGCAGGGAGCTGG + Intronic
1061673491 9:132202389-132202411 GCTGCAGCCCCACAGGGGGCAGG + Intronic
1061923447 9:133794648-133794670 ACTGCAGCCCTGAGGGGGGCTGG + Intronic
1062081883 9:134628498-134628520 GCAGCAGCCCTGCTGAGGTCCGG - Intergenic
1062329229 9:136029719-136029741 GCTGCAGCCCTGCAGGGAGCCGG + Intronic
1062346049 9:136115829-136115851 GATGCAGTCTAGCGGGGGGCCGG - Exonic
1062385105 9:136306182-136306204 GCTCCCGTGCTGCTGGGGACAGG - Intronic
1062480423 9:136748372-136748394 GGTACAGTCCTCCTGGGGGTGGG - Exonic
1062491292 9:136806295-136806317 GCTGCAGCCAGGCTGGGAGCTGG + Intronic
1185615579 X:1419723-1419745 CCGGCTGTCCTGCTGGGAGCGGG - Intronic
1185736836 X:2501440-2501462 TCTGCAGTCCTGCCGGGAGGGGG - Intronic
1186349360 X:8727536-8727558 GCTGCCCATCTGCTGGGGGCAGG + Intronic
1186404737 X:9291898-9291920 GCCGCAGCCCTGCCGGGGGCCGG - Intergenic
1187230454 X:17416651-17416673 GCTGCAAGCCTGGTGAGGGCCGG + Intronic
1187259402 X:17671286-17671308 GCTGCAGCTCTGCTGAGTGCTGG - Intronic
1187856013 X:23636848-23636870 CCTGCAGTCCTGCTGGTGATGGG - Intergenic
1187943261 X:24401981-24402003 AGTGCAGTCCTCCTGGGGACAGG + Intergenic
1190620859 X:52285279-52285301 GCTGCAGCCATACAGGGGGCAGG + Intergenic
1190622260 X:52299128-52299150 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1190683407 X:52849273-52849295 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1192395902 X:70780735-70780757 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1192436276 X:71145487-71145509 GCTGCAGCGGTGCTGGGCGCGGG - Intronic
1192727517 X:73768324-73768346 GCTGCAGCCTTGCTGGGGGAGGG + Intergenic
1193544375 X:82808505-82808527 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
1194914226 X:99685322-99685344 GCAACAGTGCTGCTGGTGGCTGG - Intergenic
1195402740 X:104478921-104478943 GCAGCAGCCCAGCTGGGTGCAGG - Intergenic
1195776392 X:108410760-108410782 GCTGGAGTCTTGCTGGGGAAGGG - Intronic
1196872427 X:120125593-120125615 GCAGCAGTCCTGCAGGGAGTGGG - Intergenic
1197609444 X:128622536-128622558 GCTGCAGCCTTGCAGGGAGCTGG - Intergenic
1198079950 X:133230190-133230212 GCAGCAGTCCTTCTGGTGGTTGG - Intergenic
1198097102 X:133390854-133390876 GCTGCTGACCAGCTGGGGGATGG - Intronic
1198203217 X:134442441-134442463 GCAGTAGTCCTGCTTGAGGCAGG - Intergenic
1198240042 X:134775951-134775973 TCTGCAGTCATGCTGAGGACAGG + Intronic
1199250835 X:145659865-145659887 GCTGCAGTGGTGCAAGGGGCGGG - Intergenic
1199876070 X:151929444-151929466 TCTTCATGCCTGCTGGGGGCTGG + Intergenic
1199951041 X:152706427-152706449 TCTTCATGCCTGCTGGGGGCTGG + Intergenic
1199958643 X:152762034-152762056 TCTTCATGCCTGCTGGGGGCTGG - Intergenic
1200019212 X:153187990-153188012 TCTTCATGCCTGCTGGGGGCTGG + Intergenic
1200089708 X:153628760-153628782 GAGGCAGGCCTGCTGGGGGAGGG - Intergenic
1200100065 X:153685853-153685875 GGTCCAGACCAGCTGGGGGCGGG + Intronic
1200101796 X:153692044-153692066 TCTGCTGGCCTGCTGGGTGCTGG + Exonic
1200244483 X:154515869-154515891 GCGGGACCCCTGCTGGGGGCGGG + Exonic
1201426008 Y:13851642-13851664 GCAGCAGTGCGGCTGGGGGAGGG - Intergenic
1201583104 Y:15531972-15531994 GCGGCAGTCTGGCTGGGGGTGGG - Intergenic
1201626829 Y:16024140-16024162 GCTGCAGTGAGGCTGGGGGAGGG - Intergenic
1201899582 Y:19035044-19035066 GCTGCAGCCAGGCTGGGGGAGGG + Intergenic
1202344450 Y:23906455-23906477 GCTTCACTCATGCTGGGAGCTGG + Intergenic
1202526318 Y:25763628-25763650 GCTTCACTCATGCTGGGAGCTGG - Intergenic