ID: 1104645693

View in Genome Browser
Species Human (GRCh38)
Location 12:130495759-130495781
Sequence TGCCCAGTGATCTAACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104645693_1104645697 21 Left 1104645693 12:130495759-130495781 CCACTATGTTAGATCACTGGGCA 0: 1
1: 0
2: 2
3: 7
4: 90
Right 1104645697 12:130495803-130495825 ACATCTAGAAAGGTACTTTATGG 0: 1
1: 0
2: 1
3: 13
4: 158
1104645693_1104645694 11 Left 1104645693 12:130495759-130495781 CCACTATGTTAGATCACTGGGCA 0: 1
1: 0
2: 2
3: 7
4: 90
Right 1104645694 12:130495793-130495815 TTGAACCCTTACATCTAGAAAGG 0: 1
1: 0
2: 0
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104645693 Original CRISPR TGCCCAGTGATCTAACATAG TGG (reversed) Intronic
901655359 1:10766235-10766257 TGCCCAGTGATCTGGCGGAGTGG - Intronic
903271449 1:22190863-22190885 TGCCAAGTGAGCTAACATGGCGG + Intergenic
907867019 1:58408188-58408210 GACCCAGTGATCTGACAGAGAGG + Intronic
908002326 1:59692613-59692635 TGTCCTCTCATCTAACATAGTGG - Intronic
908020777 1:59896212-59896234 TGCCCACTGATATAAGCTAGGGG - Intronic
909398583 1:75198615-75198637 AGCCCAGTGATATAGCATGGAGG - Intergenic
911979840 1:104553145-104553167 TGCCCTGTGATCCAAGAGAGTGG - Intergenic
917767639 1:178240088-178240110 TGCCCTGTGATGTAACATTAGGG + Intronic
920709637 1:208282722-208282744 TGGTCAGTGCTCTAACAGAGAGG + Intergenic
921927808 1:220726980-220727002 TGCACAGTGATCTAACAGAGTGG - Intergenic
922803187 1:228373295-228373317 AGCCCTGGGACCTAACATAGCGG + Intronic
923033386 1:230267418-230267440 AGCCCAGTGATTAAACATGGAGG - Intronic
1063769005 10:9176362-9176384 TACCCAGTGACCTGACACAGTGG - Intergenic
1067757598 10:49016717-49016739 TTCCCTGTGAGCTAACAGAGTGG + Exonic
1071292348 10:84196784-84196806 GGCCCAGAGATCTCACAGAGTGG - Intronic
1075443818 10:122500185-122500207 TGGCCAGTAATCTTTCATAGAGG - Intronic
1080231289 11:30019251-30019273 TGCACAGTGATATCACATTGTGG - Intergenic
1081929327 11:46857851-46857873 TGCTCAGGGATCTAAGTTAGTGG - Exonic
1084874773 11:72123243-72123265 TGCTCAGTGACCTAATCTAGAGG + Intronic
1093094117 12:14953050-14953072 TGTCCATTTATCTAACATATAGG + Intronic
1098105308 12:67063829-67063851 AGCCCAGTGGTCAAACAAAGAGG - Intergenic
1099066144 12:77982475-77982497 TGCTCAGTGATCAAAGTTAGAGG + Intronic
1103736861 12:123066172-123066194 TGCCCAGTGATGTATCCGAGAGG + Intronic
1104455438 12:128907713-128907735 TTCCCAGGGATCTCACATGGGGG - Intronic
1104645693 12:130495759-130495781 TGCCCAGTGATCTAACATAGTGG - Intronic
1110792712 13:79602734-79602756 TGCCCAGTGATTATACAGAGTGG - Intergenic
1112194687 13:97213589-97213611 TGCCCAGAGATCTCACTTTGGGG + Intergenic
1116178757 14:41508893-41508915 TGTCCAGTGATCGTACTTAGTGG + Intergenic
1116781757 14:49244317-49244339 AGCCAAGTGATCTCACACAGCGG + Intergenic
1121335374 14:93074734-93074756 TTCCCAGTGAACCATCATAGAGG + Intronic
1121885662 14:97540456-97540478 TGGCCTGAGAACTAACATAGCGG - Intergenic
1124322927 15:28728701-28728723 TGCTCAGTGATCAAACACAAAGG - Intronic
1130374032 15:83312215-83312237 TGCCCAGTGCTCCAACAAAGGGG + Intergenic
1131437326 15:92433632-92433654 TCCCTAATGGTCTAACATAGCGG - Intronic
1132351364 15:101141661-101141683 TGCCCAGTCAGCTATCACAGAGG - Intergenic
1134602483 16:15544381-15544403 TGCCCAGTGAACTAAATTATGGG - Intronic
1134609688 16:15598394-15598416 TGCCCAGTGATATAACAGACAGG - Intronic
1141525008 16:84605345-84605367 TGCCCAGTGACCCAGCATCGCGG - Intronic
1143524255 17:7463162-7463184 CGCACAGTGATCTGACACAGTGG + Exonic
1143835983 17:9693362-9693384 TGCCCAATGACCTAACATAGCGG - Intronic
1147007758 17:37418006-37418028 TGCACAGTGATTCAACATATGGG - Intronic
1149576783 17:57719310-57719332 TGCCCGCTGAGCTGACATAGCGG - Intergenic
1155421156 18:25657956-25657978 TGCCACGTGATCTCACATATAGG - Intergenic
1164872650 19:31658964-31658986 TGCCCAGAGATCTTAGGTAGGGG + Intergenic
1166506036 19:43372423-43372445 CGCCCAGGGATCTAGCATGGTGG - Intergenic
931704380 2:64935202-64935224 GGCCAAGTGATTTAACCTAGAGG + Intergenic
937711632 2:124986291-124986313 TGCCCAGTGCTGTAGCTTAGTGG + Intergenic
937968528 2:127532858-127532880 TGCCCACTGTTCTTCCATAGTGG + Intergenic
938322406 2:130373899-130373921 TGTCTAGTAATCTAACTTAGGGG - Exonic
940967810 2:159859630-159859652 TGCCTAGTCATATAGCATAGTGG + Intronic
942995722 2:182257641-182257663 TGCACAGTCTTTTAACATAGGGG + Intronic
945352444 2:208797576-208797598 AGCCCAGTTATCTCACACAGGGG - Intronic
948188970 2:236044013-236044035 TGCCCAGTGAGCAGACAGAGGGG - Intronic
1176090463 20:63316272-63316294 GGCCCAGTGATTTACCATGGTGG + Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
952344643 3:32472209-32472231 TGCCCAGTGATCAATTATGGAGG + Intronic
952894346 3:38067348-38067370 TACCAAGAGATCCAACATAGGGG + Intronic
958490658 3:94767619-94767641 TGTACAGTGATCTAAAATTGTGG + Intergenic
959730497 3:109595869-109595891 TGTCCAGTGAATTATCATAGGGG - Intergenic
961821109 3:129576114-129576136 TCCCCAGTGATCTAACCCAGGGG + Intronic
961897431 3:130180238-130180260 TGCCCAGTGGTCTATCTAAGAGG - Intergenic
963529052 3:146450554-146450576 TGGGCAGTGATCTTACATATGGG + Intronic
964120860 3:153181851-153181873 TTCACAGTCATCTAACAGAGAGG - Intergenic
971841240 4:31855489-31855511 TGTCCACTGTTCTAACAGAGGGG + Intergenic
976770981 4:88652683-88652705 TCCCAAGTGATATAACAGAGAGG - Intronic
981638248 4:146905843-146905865 TACCCGGTGAACTAACATTGAGG - Intronic
985891301 5:2717218-2717240 TGCCAAGGGATCGAACAAAGGGG - Intergenic
989272619 5:39550698-39550720 TGGCCAATGATCAAACATAGTGG - Intergenic
989475568 5:41869837-41869859 TGCCCAGAGATCCAACATCGGGG + Intronic
989481595 5:41936816-41936838 TATCCAGTGATCTAACTCAGGGG + Intronic
991037091 5:62138518-62138540 TGCCCAGAGAACTAACAGAAAGG - Intergenic
991211392 5:64108629-64108651 TTGCCAGTGATCTAATACAGGGG + Intergenic
997778605 5:136634447-136634469 GGATCAGTGATCTAAAATAGAGG - Intergenic
998280449 5:140802180-140802202 TGTGCAGTGATCTGACATTGGGG - Exonic
998286059 5:140862189-140862211 TGTGCAGTGATCAAACATTGGGG - Intronic
998972924 5:147611820-147611842 TCCCCAGTGATCTCAAAGAGTGG - Intronic
999644237 5:153702038-153702060 TGCCAAATTATCTAACCTAGAGG - Intronic
999882189 5:155878020-155878042 TCCCCAATGATATAACACAGAGG + Intronic
1000712130 5:164593494-164593516 TGCCCAATGACCTATCAAAGAGG - Intergenic
1009446535 6:63749329-63749351 TGCACTGTGATCTGACAGAGTGG + Intronic
1019138224 6:169925493-169925515 TGCCAACTGAGCTAACATGGTGG - Intergenic
1022664851 7:32401070-32401092 TGCACTGTTATCTAAAATAGTGG + Intergenic
1029698523 7:102230542-102230564 TGCTCAGTGATCTAACAGCCTGG + Intronic
1033321336 7:140342444-140342466 TGCCCAGTGGTCAAAGAAAGAGG - Intronic
1034530780 7:151695125-151695147 TGCCCAGTGACATAACAGGGGGG + Intronic
1035936511 8:3847202-3847224 TGCCCTGTAATGTAACATAATGG - Intronic
1045523662 8:102925158-102925180 TGCCCAGTGTTCTCACCCAGTGG - Intronic
1045999550 8:108402798-108402820 TCCCCAGTGCTCTAAGACAGAGG + Intronic
1046020814 8:108662609-108662631 TGCCCAGTTATGTACTATAGTGG + Intronic
1050066169 9:1761604-1761626 TGCCCAGTGATGGCACAGAGAGG + Intergenic
1055349689 9:75373508-75373530 AGCCCAGTGATGTAAGATAATGG - Intergenic
1055374638 9:75635844-75635866 TGCCCAGTCATATAACACAGGGG + Intergenic
1055488820 9:76783572-76783594 TGCCCAGTGAAGAAACAGAGAGG + Intronic
1056693454 9:88827270-88827292 TGGCCAGGGAGCTAACAAAGGGG + Intergenic
1061692642 9:132346338-132346360 TGCCCAGTGATGTCAAACAGTGG + Exonic
1186893812 X:13986545-13986567 TGCCCAGAATTCTGACATAGTGG - Intergenic
1192129761 X:68538402-68538424 TGCACAGTGATGTAAAATAAAGG - Intergenic
1194525746 X:94975633-94975655 TGCACTGTGTTCTAACAGAGAGG + Intergenic
1195345267 X:103944100-103944122 TGCCCAGTGATGTCAGGTAGAGG - Intronic
1197886388 X:131222423-131222445 TGCCCTGTGACCTAAATTAGAGG + Intergenic