ID: 1104646099

View in Genome Browser
Species Human (GRCh38)
Location 12:130498504-130498526
Sequence CTGGTCACTTGCACATCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104646099_1104646109 9 Left 1104646099 12:130498504-130498526 CCCAGTGATGTGCAAGTGACCAG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1104646109 12:130498536-130498558 CTCTGGTCCTTTAGACCAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 93
1104646099_1104646105 -8 Left 1104646099 12:130498504-130498526 CCCAGTGATGTGCAAGTGACCAG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1104646105 12:130498519-130498541 GTGACCAGCAAGGGGGCCTCTGG 0: 1
1: 0
2: 4
3: 20
4: 186
1104646099_1104646107 6 Left 1104646099 12:130498504-130498526 CCCAGTGATGTGCAAGTGACCAG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1104646107 12:130498533-130498555 GGCCTCTGGTCCTTTAGACCAGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104646099 Original CRISPR CTGGTCACTTGCACATCACT GGG (reversed) Intronic
901159848 1:7167334-7167356 CTTGACATATGCACATCACTGGG - Intronic
901299030 1:8185145-8185167 CTGGTCCCTTCCACAGCACTTGG + Intergenic
902787543 1:18742796-18742818 CAGGGCATTTGCACATCCCTTGG + Intronic
903483701 1:23673834-23673856 CTGGTCATTTGCCAGTCACTGGG + Intergenic
905395849 1:37665897-37665919 CTGGTCACTTGTTCCTGACTGGG - Intergenic
909497799 1:76298822-76298844 CTTGCCACTTGCACATCCCATGG + Intronic
910374995 1:86558784-86558806 CTGGTCCCTTCCACAACACGTGG + Intronic
916851147 1:168705352-168705374 CTGTTCATGTGCACATCAATTGG - Intronic
924819745 1:247477426-247477448 CAGGTAAATTGCACATCACAGGG - Intergenic
1062768264 10:81433-81455 CTGGTGACTTTCAAAGCACTGGG + Intergenic
1063037696 10:2303357-2303379 CTGATCACTTGCAGAGCACCGGG + Intergenic
1066515651 10:36157008-36157030 CTGATGGCTTGGACATCACTAGG + Intergenic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1068584447 10:58781083-58781105 CTGGTCACTTTCTCTTCATTAGG + Intronic
1074520191 10:114213564-114213586 CTGGTTTCTTTCACGTCACTGGG - Exonic
1076745692 10:132512470-132512492 CGGGTCACTTGCCCATTCCTAGG + Intergenic
1077333434 11:1993303-1993325 CTGGACACGTCCACATCTCTGGG - Intergenic
1078843835 11:15104283-15104305 CTGGCACCATGCACATCACTAGG - Intergenic
1079952820 11:26825178-26825200 CAGGTCTCTTCCCCATCACTGGG + Intergenic
1082577781 11:54831089-54831111 ATGGACATTTGCAGATCACTGGG + Intergenic
1084870779 11:72097425-72097447 GTGCTCACATGCACCTCACTAGG - Exonic
1086876924 11:92108368-92108390 CTGGCCACTTGGCCCTCACTTGG + Intergenic
1088965530 11:114717245-114717267 CTGTTCATCTGCACACCACTGGG - Intergenic
1202816412 11_KI270721v1_random:48485-48507 CTGGACACGTCCACATCTCTGGG - Intergenic
1094348883 12:29500776-29500798 CTGGTGACATGGACATCAGTAGG + Intergenic
1095620941 12:44252611-44252633 CTCTTCATTTGCACATCCCTTGG + Intronic
1097366535 12:58720542-58720564 CTCCTCACTTGGACCTCACTTGG + Intronic
1098539376 12:71636760-71636782 CTGGTTACTTGGGCATCATTGGG - Intronic
1101273585 12:103174829-103174851 CTGGGAACTTTGACATCACTTGG - Intergenic
1101565571 12:105901861-105901883 CTGGTCCCTCCCACAACACTTGG - Intergenic
1104019924 12:124985262-124985284 CTGGTCACTTTCCCACCTCTGGG - Intronic
1104646099 12:130498504-130498526 CTGGTCACTTGCACATCACTGGG - Intronic
1105609120 13:21952231-21952253 CTACTCACTTTCATATCACTGGG - Intergenic
1105788862 13:23777259-23777281 GTAGAGACTTGCACATCACTGGG - Intronic
1105881530 13:24610498-24610520 CTGCTGACTCTCACATCACTGGG + Intergenic
1106481636 13:30141289-30141311 CTGGTCTCCTTCACCTCACTGGG + Intergenic
1110242681 13:73286368-73286390 GTGGTCACTGGCACAACTCTAGG + Intergenic
1110760872 13:79229003-79229025 TTGGTCACTTGCAGGTCACAAGG + Intergenic
1111525389 13:89461526-89461548 CAGGTCCCTTGCAAATGACTGGG + Intergenic
1112637265 13:101228424-101228446 CTGGTCCCTTCCACAACACATGG - Intronic
1113885040 13:113654357-113654379 CTGGTCACCTACACATCAGCAGG - Intronic
1114649994 14:24278477-24278499 AAGGTCACTTGCACATAATTGGG + Intergenic
1114761967 14:25325961-25325983 CTGGTCATTTCCACATCCCCAGG + Intergenic
1117707921 14:58492156-58492178 CTAATCACTTGCCCTTCACTAGG - Exonic
1118405064 14:65413764-65413786 CTCGTCATTTGCACATCAAAAGG - Intronic
1119167776 14:72509685-72509707 CTGACCAGTTGTACATCACTTGG + Intronic
1119768124 14:77203589-77203611 CTGGCTACTTTCACACCACTTGG + Intronic
1120178322 14:81318319-81318341 CTGCTTACTTCCACATCACGAGG + Intronic
1122596645 14:102898429-102898451 CTGATGACTGACACATCACTGGG - Intronic
1122742961 14:103882384-103882406 CTGGTTTATTTCACATCACTGGG + Intergenic
1123405978 15:20019698-20019720 CTGGTGACCTGAACATCACAGGG + Intergenic
1123515308 15:21026346-21026368 CTGGTGACCTGAACATCACAGGG + Intergenic
1124225778 15:27893656-27893678 CTGGTCTCTTGCAGAACCCTCGG + Intronic
1125767622 15:42145912-42145934 CTGGTGACTTTCCCTTCACTCGG - Intronic
1132457164 16:30564-30586 CTGGTGACTTTCAAAGCACTCGG + Intergenic
1133269579 16:4604149-4604171 CTTGTCAGTGGCACAGCACTAGG - Intergenic
1133342684 16:5046970-5046992 CTGGTCACTTGCCCATTCATTGG + Intronic
1138526245 16:57609063-57609085 CTGGTCACTTGAGGATCACCTGG + Intergenic
1138664691 16:58555347-58555369 CTGGTCACTTACATGGCACTAGG - Exonic
1140511867 16:75514467-75514489 CAGGTCCCTTGCACAACACATGG - Intergenic
1142075923 16:88117765-88117787 CAGGTCACTTGCACACGACCGGG - Intronic
1143282101 17:5762588-5762610 CTGTGCACTTGCAGTTCACTAGG - Intergenic
1146723641 17:35140563-35140585 CAGGACACTTACACAGCACTTGG + Intronic
1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG + Intergenic
1148779010 17:50111311-50111333 CTGGTCACTGGCACATCATAAGG + Exonic
1152724930 17:81940507-81940529 CTGGTCACTGGAACATCATAAGG - Exonic
1152961151 18:81288-81310 CTGGTGACTTTCAAAGCACTGGG + Intergenic
1154490847 18:14921073-14921095 CTGATCACTTCCTCATTACTGGG - Intergenic
1156666441 18:39413580-39413602 CTGGTCACTGCCACATCTCCTGG - Intergenic
1157077642 18:44482999-44483021 CTGCTCACAGGCACATCCCTTGG - Intergenic
1163625789 19:18388702-18388724 ATGGTCACTTGCACCTCCCGTGG - Exonic
1166802632 19:45467822-45467844 CTGGTCACTTGCATGACCCTCGG - Intronic
925453506 2:3991834-3991856 CAGGTCCCTTGCACAGCACACGG + Intergenic
925716243 2:6786673-6786695 AAGGTCACTTTCACATCTCTGGG + Intergenic
925981795 2:9183056-9183078 CTGGTCCCTTCCACAACACATGG - Intergenic
926136233 2:10338586-10338608 CTGGTCACCAACACAGCACTGGG - Intronic
926367257 2:12144765-12144787 CTGGGAACTTGCTCATCAGTTGG + Intergenic
928209072 2:29310526-29310548 CAGGTCACTTACAAATCACTTGG - Intronic
932598997 2:73111586-73111608 CCGGTCACTTCCACCTCAGTGGG - Intronic
932967513 2:76494289-76494311 CTGGATACTTGCTAATCACTCGG - Intergenic
934071924 2:88392197-88392219 AGGTTCACTTGCACATCACTTGG + Intergenic
935284491 2:101552073-101552095 CTGGGCACATGCACAGAACTAGG - Intergenic
945624296 2:212182267-212182289 CAGGTCATTTGCAAATCACTGGG + Intronic
945983907 2:216339416-216339438 CTTGGCATTTGCACATCACAGGG + Intronic
947008319 2:225537604-225537626 CTGGTCCCTTCCACAACACTTGG + Intronic
947008665 2:225540563-225540585 TTGGTCCCTTCCACAACACTTGG + Intronic
947237060 2:227951894-227951916 CAGGTCCCTTCCACAACACTTGG - Intergenic
947451200 2:230210878-230210900 CTGGTCATTTCTATATCACTTGG - Intronic
947682346 2:232046078-232046100 CTGGACACTGTCACAACACTTGG + Intronic
948681949 2:239641080-239641102 CTGGTCACTGCCACATCTCACGG - Intergenic
1171183854 20:23110991-23111013 AAGGTCACATGCACAGCACTGGG + Intergenic
1174531653 20:51219275-51219297 CTGGTCCCTTGCATCTCACCTGG - Intergenic
1176677340 21:9791538-9791560 CAGGTCACTTCCACAACACCTGG - Intergenic
1178384711 21:32139712-32139734 CTGGTCCCTCCCACAACACTTGG - Intergenic
1178514745 21:33237010-33237032 CTGGTGACTTATACTTCACTTGG - Intronic
1183395079 22:37566892-37566914 GTGGTCACTTGGAGCTCACTTGG - Intronic
951139983 3:19148028-19148050 CTGCTCCCTTGGACACCACTGGG + Intergenic
951310828 3:21124728-21124750 CTGGCCACTTGCACTTCCCGGGG - Intergenic
954648108 3:52143714-52143736 CTGGACACCTACCCATCACTGGG + Intronic
955065520 3:55530767-55530789 ACTGTCACTTGCTCATCACTGGG + Intronic
963579288 3:147104177-147104199 CAGGTCCCTTGCACAACACGTGG - Intergenic
963666231 3:148191034-148191056 CTGCTCACTGGCAAATGACTAGG - Intergenic
964472119 3:157067046-157067068 ATGGCCACTTGGGCATCACTTGG + Intergenic
964579508 3:158217329-158217351 CTGCTCACTTGCATGTGACTGGG + Intronic
966973343 3:185065302-185065324 CAGGTCACATGCCCACCACTTGG + Intergenic
970707885 4:18826768-18826790 CGGGTCCCTTGCACAGCAGTTGG + Intergenic
972816533 4:42652631-42652653 CAGGTCTCTTCCACAACACTTGG - Intronic
975238820 4:72032351-72032373 TTGGTCACTGGCCCAACACTGGG + Intronic
975858095 4:78646289-78646311 TTGGTCACTTCCAGATCACATGG + Intergenic
980005784 4:127540890-127540912 CTGGTCACCTCCCCATAACTGGG + Intergenic
983061856 4:163169568-163169590 CTGGTCTCCTGGAAATCACTGGG - Intergenic
984573888 4:181425116-181425138 CTGGACATTTGCACACCTCTAGG + Intergenic
985398199 4:189567242-189567264 CAGGTCACTTCCACAACACCTGG + Intergenic
986331020 5:6716128-6716150 CAGGTCCCATGCACCTCACTTGG + Intronic
986559417 5:9046002-9046024 CTCGTCAGTGCCACATCACTGGG + Intronic
989434786 5:41398204-41398226 CAGGTCTCTTCCCCATCACTGGG - Intronic
989805757 5:45601918-45601940 CTGGTCTCTCCCACAACACTGGG - Intronic
993556223 5:89342817-89342839 CTGGCCACTTGCACACCATCTGG + Intergenic
996066631 5:119086275-119086297 CTGGTCCCTTCCACAACACATGG + Intronic
997726792 5:136127750-136127772 TTGGTCACGTGCCCATCTCTGGG + Intergenic
1002110283 5:176904651-176904673 GTGTTCACTTGCACATTCCTGGG + Intergenic
1011650327 6:89500188-89500210 CTGGTCACTTGAGCAACACAGGG + Intronic
1011825506 6:91301370-91301392 CTGGTCACTTGGCCAGCCCTGGG - Intergenic
1015899363 6:138048522-138048544 CAGGTCCCTTGCACAACACATGG + Intergenic
1015959084 6:138628874-138628896 TTGGTCCCTTGCACATAACTGGG + Intronic
1018081452 6:160262499-160262521 CTGGGGCCTGGCACATCACTTGG + Intronic
1018401261 6:163422857-163422879 CTGGTCAGTAGCAAATCATTGGG + Intronic
1022955388 7:35375643-35375665 CTGGTCTCTTGAACATCTCAAGG - Intergenic
1023446565 7:40237698-40237720 CTGGTCTGATGCACATCACAGGG + Exonic
1024227269 7:47335523-47335545 CTGGGCACAAGCACATCTCTGGG + Intronic
1026316175 7:69229567-69229589 TTGGTTACCTGCACACCACTTGG + Intergenic
1028790279 7:94845357-94845379 CAGGTCCCTTGCACAACACGTGG - Intergenic
1029297928 7:99556202-99556224 CTTGTCACTTGCTGCTCACTGGG + Intronic
1029316095 7:99715859-99715881 GTGATCACTAGCACATCATTTGG - Exonic
1029321756 7:99768455-99768477 GTGATCACTAGCACATCATTTGG - Exonic
1030990854 7:116298292-116298314 CTGGTCCCTTCCACAACACAAGG - Intronic
1031725183 7:125229695-125229717 CTGGTCCCTCCCACATCACATGG + Intergenic
1031990778 7:128197584-128197606 CTGGACCCTGGCACATCCCTAGG - Intergenic
1032891449 7:136199519-136199541 CTGCACCCATGCACATCACTGGG - Intergenic
1035692072 8:1566739-1566761 ATGGTCACTGGCTCATCACTGGG - Intronic
1037660144 8:20919385-20919407 CTGGTCCCTCCCACAACACTTGG + Intergenic
1037907989 8:22726766-22726788 CTGGCCTCTGGCACAGCACTGGG - Intronic
1042384452 8:68156732-68156754 CTGGTCACCTCCCCATAACTGGG - Intronic
1044029323 8:87214877-87214899 CTGGTCCCTCCCACAACACTTGG + Intronic
1048071397 8:131025509-131025531 ATGGACACTGGCACATCACGCGG - Intronic
1048186456 8:132246185-132246207 CTGGGCACTTGCACAAGAATAGG - Intronic
1048667757 8:136682613-136682635 CTGGGCAATTGGACATCAATAGG - Intergenic
1051627054 9:19108222-19108244 TTAGTCACATGCCCATCACTAGG + Intergenic
1059373996 9:113867434-113867456 GTAGTCACTGGCCCATCACTTGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1062737008 9:138142848-138142870 CTGGTGACTTTCAAAGCACTGGG - Intergenic
1203544955 Un_KI270743v1:121666-121688 CTGGGCCATTGAACATCACTGGG + Intergenic
1189460042 X:41233564-41233586 CTGATGACTTCCACGTCACTGGG - Exonic
1191177118 X:57516369-57516391 CTGGTTACATGCACATCAACTGG + Intergenic
1194137206 X:90161042-90161064 TTGGTTACTTGCACCTCTCTGGG - Intergenic
1194843460 X:98774912-98774934 CTGGTCCCTTCCACAACACGTGG - Intergenic
1196483484 X:116178743-116178765 CTGGTCCCTTCCACAACACAAGG - Intergenic
1198429062 X:136547625-136547647 CTGGTCACTCACACAACTCTAGG - Intronic
1200399194 X:156008821-156008843 CTGGTGACTTTCAAAGCACTCGG - Intronic
1200482939 Y:3730965-3730987 TTGGTTACTTGCACCTCTCTGGG - Intergenic
1201465346 Y:14274573-14274595 CTGGTTCCTTCCACAACACTTGG - Intergenic