ID: 1104646231

View in Genome Browser
Species Human (GRCh38)
Location 12:130499570-130499592
Sequence GTGCAGGAGTAGAATGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104646231_1104646237 11 Left 1104646231 12:130499570-130499592 CCGTGTTCATTCTACTCCTGCAC 0: 1
1: 0
2: 0
3: 23
4: 225
Right 1104646237 12:130499604-130499626 ACACACTTCTCAGACACAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104646231 Original CRISPR GTGCAGGAGTAGAATGAACA CGG (reversed) Intronic
900618591 1:3576758-3576780 GTGCAGGGGTGGAATGTGCAGGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901961583 1:12830567-12830589 GTACAGGAGTGGTATGAGCATGG + Intronic
901976006 1:12944567-12944589 GTACAGGAGTGGTATGAGCATGG + Intronic
902009166 1:13257198-13257220 GTACAGGAGTGGTATGAGCATGG - Intronic
903471779 1:23592273-23592295 GTGCAGGAGAGGAAGGAACATGG + Intronic
904016453 1:27425137-27425159 GTGCTGGAGTGGCATGATCATGG + Intronic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904833516 1:33320539-33320561 GTGGAGGAGTGGACTGATCAGGG - Intronic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
907712000 1:56892035-56892057 TTGCAGGAGTAGAAGAAGCAAGG - Intronic
907820053 1:57958476-57958498 GTGCAGGAGTGGACAGAAAATGG + Intronic
908793413 1:67805533-67805555 GTTCATTAGTAGACTGAACAGGG + Intronic
910064244 1:83134375-83134397 GTGCTGGAGTAGAAAAAAGAAGG + Intergenic
910523032 1:88145127-88145149 GTGCAGGAGGAGTAGGAAGAGGG - Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
911843530 1:102717154-102717176 GTACTGGAGTGGAAAGAACAAGG - Intergenic
916583529 1:166129714-166129736 GTGCAGGAGAAGAAGCAGCAGGG - Intronic
920832107 1:209474880-209474902 GCACAGCAGGAGAATGAACAGGG + Intergenic
922496050 1:226058813-226058835 GTGCAGGAGTGGAAAGAGAAAGG + Intergenic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1062826811 10:575966-575988 GTGCAGGAGTAGCATCTGCAAGG - Intronic
1064001413 10:11666524-11666546 GCTCATGAGTAGAATGGACATGG + Intergenic
1066986812 10:42475586-42475608 GGGCAGGAGGAGAAAGAAGAGGG + Intergenic
1067052967 10:43035233-43035255 GGTGAGGAGTAGAATGAGCAAGG + Intergenic
1067743254 10:48913109-48913131 GGGCAAGAGTAGGATGGACATGG + Intronic
1069060026 10:63885562-63885584 GTTCACTAGTAGAATGAAGAAGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1071127432 10:82351528-82351550 GTGCTGGAGAAGCATGAAAAGGG + Intronic
1074357016 10:112795395-112795417 GTGTAGGAGAAAAAAGAACAAGG - Intronic
1076286238 10:129299868-129299890 GTGCAGGAGTAAATTGTTCAGGG - Intergenic
1078477407 11:11642919-11642941 TTTCTTGAGTAGAATGAACATGG - Intergenic
1078795548 11:14588812-14588834 GAGCTGGAGTAGACTGAGCAAGG - Intronic
1078974255 11:16452948-16452970 GTTCATGAGTAAGATGAACAGGG + Intronic
1081018293 11:37909491-37909513 GTGCAATAGTAGAAAGAACTGGG + Intergenic
1083838064 11:65285519-65285541 GTGCAGTAGTGGTATGATCATGG - Intronic
1084349335 11:68583860-68583882 GTGCAGCAATAGAATTAACGGGG + Intronic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1089225775 11:116920182-116920204 GGGCAGCAGTAGAATGCACAAGG - Intronic
1090397863 11:126431319-126431341 AAGCAGGAGTGCAATGAACAGGG - Intronic
1090672764 11:128961027-128961049 TGGCAGGAGTAGAAGCAACATGG - Intergenic
1091276510 11:134356328-134356350 GTGCAGGTGGAGAATGAATATGG + Exonic
1092714508 12:11375002-11375024 GTGCAGGAGTGTAATGTAAACGG - Intronic
1093225791 12:16481621-16481643 GTCAAGGAGTAGATTGGACATGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1095414808 12:41965217-41965239 GTGCAGTGGTAGAAGGAGCAGGG - Intergenic
1098454489 12:70656796-70656818 GTGCAGGAATAGGTAGAACAGGG - Exonic
1098556066 12:71820327-71820349 GTGACTGAGTAGAATGAGCAAGG - Intergenic
1103991970 12:124805382-124805404 GGGCTGGAGAATAATGAACAGGG + Intronic
1104121916 12:125807979-125808001 GTGCAGGGGTTGAAGGAATAAGG + Intergenic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1104885163 12:132103066-132103088 GTGCAGGAGGAGCATGAAAGTGG - Intronic
1106484991 13:30164230-30164252 ATGCATGAGAAGAATGAACAGGG + Intergenic
1106616430 13:31333999-31334021 GCACAGGAGAAGAATTAACAAGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1107385538 13:39904547-39904569 GGGCTGGAGTGGAGTGAACAGGG + Intergenic
1107701021 13:43047733-43047755 GTGAAGGAGTAGAAAGTATAAGG + Intronic
1107869897 13:44736620-44736642 GGACAGGAGTAAAAGGAACAAGG + Intergenic
1111580221 13:90213131-90213153 GATCAGGAGTAAAAGGAACAAGG - Intergenic
1111649382 13:91070413-91070435 GTAAAGGAGTACATTGAACAAGG - Intergenic
1111726815 13:92021437-92021459 GTGAAAGAGTAGAATGATGATGG + Intronic
1111779436 13:92702857-92702879 GTGCTGGAGCAAAATGAACAAGG - Intronic
1114228066 14:20756702-20756724 GTACAGGAGCAGAAGAAACAAGG + Intergenic
1116659491 14:47690676-47690698 GTGTATGACTAGAATAAACAAGG - Intergenic
1118266942 14:64303496-64303518 GAGCAGGAGGAGAATGCACATGG - Intronic
1119233064 14:72996136-72996158 GGGCAGGGGGAGAATGAAAAGGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122249084 14:100425460-100425482 GGGAAGGAGTAGAAAGAGCAGGG - Intronic
1125448883 15:39787201-39787223 GTGCAGTAGCACAATGATCATGG + Intergenic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127608205 15:60611365-60611387 GGACATGAGTAGAATGAAAAAGG + Intronic
1128809729 15:70562080-70562102 GTGCAGGTGTGGGATGACCATGG - Intergenic
1128828935 15:70748635-70748657 AGGGAGGGGTAGAATGAACAGGG - Intronic
1129580439 15:76803202-76803224 GGGCAGGAGTGAAAAGAACAAGG - Intronic
1131706365 15:95000410-95000432 GTTCAGGAGGAGAACGAAGAAGG - Intergenic
1132709527 16:1260202-1260224 GTCCAGGTGCAGAATGAACACGG + Intergenic
1133648887 16:7790834-7790856 GTGAAAGAGTAGATTGCACAAGG - Intergenic
1133791644 16:9013579-9013601 GTGCTGGAGCAGAGCGAACACGG + Intergenic
1134320100 16:13155075-13155097 ATACTGGAGTAGAATGAACTGGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134884591 16:17778433-17778455 GTGCAGGTGTAGAAGAAAGAAGG - Intergenic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1137235170 16:46610607-46610629 GTGCAGTAGTAGCATGACCTCGG + Intronic
1137411228 16:48229947-48229969 GAGTAGGAGAAGAATGATCAAGG - Intronic
1138070568 16:53989233-53989255 CTTCAGGAATAGAATGAACAGGG + Intronic
1138482809 16:57315182-57315204 GTGGAGGAGGAAAAAGAACAAGG - Intergenic
1138677368 16:58661443-58661465 TTGCAGAACTAGAAGGAACAGGG - Intergenic
1140748854 16:78005277-78005299 GTAGAGGAGGAGAATGAACTTGG + Intergenic
1141096351 16:81165769-81165791 GTGCCGGTGTGGAATGAACCAGG + Intergenic
1141692700 16:85605636-85605658 GTGCAGGGGGAGGATGGACATGG - Intergenic
1143295059 17:5864849-5864871 GGGCAGGAGAAGAAAGATCAAGG - Intronic
1144045873 17:11454181-11454203 GTGCAGAAATAGATTGAATATGG - Intronic
1146666059 17:34704490-34704512 GTCCAGGAGTAGAAAGAAAATGG - Intergenic
1148558315 17:48591691-48591713 GAGGAGGAGGAGAATGAAAAGGG + Exonic
1151350237 17:73527542-73527564 GAACAGGAGAAGAATGCACAGGG + Intronic
1151872900 17:76848653-76848675 CTGCAGTTGTAGAATGTACAAGG + Intergenic
1152266326 17:79296995-79297017 GGGCAGGAGGAGAAAGAAGAGGG - Intronic
1153679864 18:7490479-7490501 GGGCTGGAGTTGAATGAGCAAGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1156373526 18:36492112-36492134 GTGGAGGACTGGAAAGAACACGG - Intronic
1156565323 18:38182440-38182462 ATGCAGGATTAGAATTAAAAGGG - Intergenic
1164644987 19:29852201-29852223 CTGCAAGAGCAGGATGAACAGGG + Intergenic
1165691856 19:37869693-37869715 TTGAAGGCGTAGGATGAACAGGG - Intergenic
1166292505 19:41872088-41872110 GTGCAGAAGTTGAATTACCAGGG + Exonic
1166514645 19:43437317-43437339 GTGCAGGAGGAGCATGAAAGTGG - Intergenic
1168053509 19:53847627-53847649 GTGCTGGAGGAGAGTGAACGAGG - Intergenic
928446009 2:31333742-31333764 GGGCAGTAGAAGATTGAACAAGG - Intergenic
928715719 2:34057430-34057452 GTGCAGCAGAGGAATAAACAGGG + Intergenic
929951473 2:46413189-46413211 GGGCAGGAGTATTAAGAACAGGG - Intergenic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
931520130 2:63087493-63087515 GTCCTGGAGTAGAAATAACATGG - Intergenic
932290644 2:70575177-70575199 TTGCAGGGGTAGAAGGAACAAGG + Intergenic
933362249 2:81303065-81303087 GTGCATGAGTACAATAAGCAAGG - Intergenic
936989741 2:118349978-118350000 ATGCAGGGATAGAATGAAGAAGG + Intergenic
937573360 2:123390992-123391014 GGGGAGGAGGAGAATGAAGAAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942642287 2:178072638-178072660 GAGCAGGAGTAGCAGGACCACGG - Exonic
943127212 2:183809248-183809270 GTGCAAGAGAAAAATCAACAAGG - Intergenic
944288013 2:197973910-197973932 GTGGAGGAGTAGAGAGAATAGGG + Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
945450528 2:209989682-209989704 GTGCAATACTAGAATGAACCAGG - Intronic
945855401 2:215063502-215063524 GAGCAGGTGAAGAATGAATAGGG - Intronic
946891600 2:224282654-224282676 ATCCAGGAGGAGAATGAAAAGGG + Intergenic
948927517 2:241108795-241108817 CTGCAGGACGAGACTGAACAGGG + Intronic
1171232800 20:23500769-23500791 GTGCAGGTGAAGGGTGAACAGGG + Intergenic
1172669792 20:36627116-36627138 ATGCAGCGGTAGAAAGAACAAGG + Intronic
1175530364 20:59670758-59670780 GTGCAGTAGAAGATGGAACATGG - Intronic
1175537318 20:59723796-59723818 GGTCAGGAGTAGAATGTTCATGG + Intronic
1176929726 21:14794592-14794614 GTGTAAAAGTAGAATGAACGTGG - Intergenic
1177772240 21:25529842-25529864 GGGCAGAAGTGGAGTGAACATGG - Intergenic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1179179815 21:39035778-39035800 GAGCAAGAGGAGAATGGACAGGG - Intergenic
1180998000 22:19975027-19975049 GGGCAGGAGTAGAGGGAGCATGG - Intronic
1181913084 22:26256067-26256089 GGGCAGGAGAAGGATGAATAAGG - Intronic
1182293743 22:29301072-29301094 GTGCAGGTGAAGAATGAAGTGGG - Intergenic
1183148681 22:36019289-36019311 GTGGAGGAGTGGAATGAACTGGG - Intronic
950967164 3:17154476-17154498 GAGCTGGAGTCGAAGGAACAAGG + Intergenic
951216990 3:20034491-20034513 GTGAAGGAGTATATTGAGCATGG + Intergenic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
953754564 3:45635380-45635402 GGGCAGGAGTAGAATGTACTAGG + Intronic
954166027 3:48758668-48758690 GGGCCTGAGGAGAATGAACAGGG + Intronic
954894568 3:53964592-53964614 GAACAGGAGTGGAAGGAACATGG - Intergenic
955241920 3:57185932-57185954 GGGCAGGAGAAGAAGGAGCAAGG - Intergenic
956295171 3:67704491-67704513 GAGCAGGAGGACAATGAACTAGG - Intergenic
956652188 3:71514380-71514402 GTGCAGGAGAAGAAAAACCAGGG - Intronic
959368710 3:105495390-105495412 GAGCACTAGAAGAATGAACAGGG + Intronic
959927337 3:111938261-111938283 GTGCAGGGGCAGAAGGAATATGG - Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
964893069 3:161559671-161559693 GAGCAGGAATAGGAAGAACAAGG - Intergenic
965447701 3:168796105-168796127 GGGCTGGAAAAGAATGAACAAGG + Intergenic
965776333 3:172235574-172235596 GTACAGTAGTAGAAAGAGCAGGG + Intronic
966773691 3:183525643-183525665 GTGGCAGAGTAGAAAGAACACGG - Intronic
967343979 3:188432961-188432983 GTGCAGGATAGGAATGAACAAGG + Intronic
967389867 3:188945147-188945169 GTGCCGGCGGAGAATGAGCAGGG - Intergenic
969838952 4:9866532-9866554 GGGCAGTTGTAGAAAGAACAAGG - Intronic
973533619 4:51858389-51858411 GTGGCTGAGTAGAATGAACAAGG + Intronic
973788322 4:54355735-54355757 ATGCTGGAGAAGAATGATCAAGG + Intergenic
975145001 4:70957343-70957365 GTGAAGGAGAATAATGGACAGGG + Intronic
975446855 4:74475329-74475351 GTGCATGAGTACAATAAGCAGGG + Intergenic
976880659 4:89920886-89920908 GTGAGGGAGTGGAAAGAACATGG + Intronic
977347189 4:95830972-95830994 AGGCAGGAGTACAATCAACAAGG + Intergenic
977422423 4:96818944-96818966 GAGCAGGAGGAGAGAGAACAGGG - Intergenic
977521410 4:98089033-98089055 TGGCAGGATTAGAATGAAGAAGG - Intronic
978436891 4:108695249-108695271 GTGGTGGAGTTGAGTGAACAAGG + Intergenic
979650048 4:123118169-123118191 GTACAGTGGTAGAAGGAACAAGG - Intronic
980279258 4:130698028-130698050 GGGCAGTAGTAGAATTAATAGGG + Intergenic
980463856 4:133150210-133150232 GTACAGGAGGAGCAGGAACATGG + Exonic
981023054 4:140048926-140048948 GTGAAGAGGAAGAATGAACAGGG + Intronic
983022198 4:162691641-162691663 GAGGAGGAGTAGAAAGCACATGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985599768 5:821180-821202 GGGCAGGAGAAGAAGGAAGAGGG + Intronic
985845079 5:2338545-2338567 GTGCAGAGTTAGAATAAACATGG + Intergenic
988770433 5:34427499-34427521 CTGCAGGAGTAGAATTCTCATGG - Intergenic
990159805 5:52924768-52924790 GAAGAGGAGTAGAATGGACAGGG + Intronic
992213818 5:74506514-74506536 GTGCTGGAGTGGAAAGAAGAAGG - Intergenic
996487510 5:124054398-124054420 GTGCAGGAGTAGAGTCTAGAAGG + Intergenic
997702227 5:135910872-135910894 AGGCAGGAGAAGAATGAACCAGG + Intergenic
997849086 5:137314766-137314788 GTGGAGGAGTAAAGAGAACATGG - Intronic
998835224 5:146196795-146196817 GGGCTGGAGCAGAATGAACCAGG - Intergenic
999782170 5:154858384-154858406 GCGCAGGAGCAGAAGTAACAGGG - Exonic
1000054406 5:157592197-157592219 GCTCATGAGTAGACTGAACATGG - Intergenic
1005511452 6:26515647-26515669 GTTCAGGAGTAGAATAAGTAAGG - Intergenic
1006575886 6:35045513-35045535 GTGTAGGGGTGGAAAGAACAAGG - Intronic
1007024426 6:38555946-38555968 GGGCAGGAATAGAATTCACAGGG + Intronic
1007478862 6:42136915-42136937 GGGGAGGAGCAGAGTGAACAGGG + Intronic
1008085673 6:47241848-47241870 GTGCAGGAGAAGAAGAAAGAAGG - Intronic
1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009439314 6:63657615-63657637 GTGGAGGAGGAGGAAGAACAGGG + Intronic
1009509976 6:64538873-64538895 CTGGTGGAGTAGAAAGAACATGG - Intronic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011751953 6:90462672-90462694 TTGAAGGTGTAGAATGAAAAGGG - Intergenic
1012280420 6:97321570-97321592 GTGGACCAGTAGCATGAACAGGG + Intergenic
1012791200 6:103698640-103698662 TTGCAGGATTAAAATCAACATGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1016727972 6:147397113-147397135 GAGAAGGAGGAGACTGAACAGGG - Intergenic
1020402348 7:7793405-7793427 GTGAAGTAGTGGAAAGAACAGGG - Intronic
1021499767 7:21319697-21319719 GTGCAGGAGTATACTTCACATGG - Intergenic
1022688681 7:32623107-32623129 GAGCAGGAGTAGGATAAAAATGG + Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024180115 7:46883876-46883898 GTGGAGCAGTAGAGTGATCATGG + Intergenic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1025965841 7:66270221-66270243 GGACTGGAGTAGAGTGAACAAGG + Intronic
1026338176 7:69412633-69412655 GTCCATGAGCAGAATGAACTTGG - Intergenic
1027279864 7:76600367-76600389 GTGCTGGAGTAGAAAAAAGAAGG - Intergenic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030334942 7:108315650-108315672 TTGCAGGAGTAGGCTGAACTTGG - Intronic
1031541151 7:122996039-122996061 ATGCAGGACGTGAATGAACAGGG - Intergenic
1034839933 7:154386382-154386404 TTGCAGGAGGAGACTGAACTTGG + Intronic
1035427213 7:158787069-158787091 GACCAGGAGCACAATGAACACGG + Intronic
1036541325 8:9715083-9715105 GTACAGGAGGAGTATGAAGAAGG + Intronic
1036651841 8:10649227-10649249 GTGGATGAGGAGAATGAAGAAGG - Intronic
1036729310 8:11248385-11248407 GTGCAGGAGTGGAAGAGACAGGG - Intergenic
1039322829 8:36451737-36451759 GTGCAGGAGTTCAAAGCACATGG - Intergenic
1040844181 8:51819195-51819217 GGGAAGGAGTGAAATGAACATGG + Exonic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042609480 8:70581940-70581962 GTGCCGGAGCAGAATGAAGGGGG + Intronic
1042612607 8:70615019-70615041 GTGAAGGAGAAGAATGGAAAGGG + Intronic
1042677436 8:71337440-71337462 GTGAAGGAGTTGGAGGAACAGGG - Intronic
1044516563 8:93145755-93145777 GTGTAGGAGTAAAAAGCACAGGG + Intronic
1044516738 8:93147696-93147718 GTGCAGGAGCAAAAAGCACAGGG + Intronic
1045056339 8:98371509-98371531 GTGCAGTAGGAGAAAGCACAAGG + Intergenic
1045322930 8:101095558-101095580 GTGCAGGAGTGGCATGATCTGGG - Intergenic
1046412071 8:113858854-113858876 GTGCTGTAGGAGAATGAAAAAGG - Intergenic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1048815812 8:138332674-138332696 GGGAAGGAGAAGAGTGAACACGG + Intronic
1049996542 9:1040584-1040606 GTGCAGCAGTGGTATGATCATGG + Intergenic
1051338050 9:16084842-16084864 GTGGTAGAGTAGAATGAACATGG + Intergenic
1051342581 9:16125562-16125584 GAGCAAGAGTAGAAAGAAGAGGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1052466402 9:28835854-28835876 GTGCAGTAATAGAAAGAAAATGG - Intergenic
1055438895 9:76319781-76319803 GTGCAGGAGGAGCATGAAAGTGG - Intronic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1186545290 X:10442770-10442792 GTGCAGAAGTAGAGAGAACTCGG + Intergenic
1187056150 X:15743085-15743107 TGGCAGGAGTAGAGTGAACCAGG - Intronic
1188330659 X:28867077-28867099 GTACAGGAGTAAAATGGCCATGG + Intronic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1193935831 X:87619959-87619981 GTGCATTGGTAGACTGAACAAGG + Intronic
1195131547 X:101858761-101858783 GTGGAGGAGTAGAAAGCACTGGG - Intergenic
1196209076 X:112974356-112974378 GTTCAGGAGTAGAATGAAACAGG + Intergenic
1202376149 Y:24239380-24239402 GAGCAGGAGAAGGGTGAACAAGG - Intergenic
1202494631 Y:25430738-25430760 GAGCAGGAGAAGGGTGAACAAGG + Intergenic