ID: 1104647569

View in Genome Browser
Species Human (GRCh38)
Location 12:130508279-130508301
Sequence AGGGAGAGGCAAGATCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104647569_1104647572 -5 Left 1104647569 12:130508279-130508301 CCTGCCAGATCTTGCCTCTCCCT 0: 1
1: 0
2: 3
3: 44
4: 364
Right 1104647572 12:130508297-130508319 TCCCTGCTTGAAACCTTCTGTGG 0: 1
1: 0
2: 5
3: 27
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104647569 Original CRISPR AGGGAGAGGCAAGATCTGGC AGG (reversed) Intronic
901175064 1:7293027-7293049 AGGAAGTGGCAAGCTCCGGCGGG + Intronic
902051354 1:13565947-13565969 AGGAAGAGGAAAGATTAGGCTGG - Intergenic
902414806 1:16232343-16232365 AGGGAGAGGCAGGGTCTGATGGG - Intronic
902668297 1:17954468-17954490 AGGGAATGGCAAGATGGGGCAGG - Intergenic
903395514 1:22999041-22999063 AGGAAGAGGAGAGATCAGGCTGG + Intergenic
903418443 1:23200969-23200991 TGGGAGAGGCATGGTGTGGCTGG - Intergenic
903641451 1:24863018-24863040 AGGGTGAGGCAGGAGCTGGTGGG - Intergenic
904709340 1:32416785-32416807 AGGGAGAGTCAAAATCTTGTAGG + Intergenic
905178213 1:36151075-36151097 AGAGAGAGGCAAAATCTCGGAGG - Intronic
905429655 1:37912323-37912345 AGGAAGAGGAGAGATCAGGCTGG - Intronic
906096558 1:43228157-43228179 AGGGAGAGGCTGGATCACGCAGG - Intronic
906205382 1:43983837-43983859 AGGGAGAGAAGAGAGCTGGCAGG + Intronic
906436505 1:45801436-45801458 AGGTAGAGGCCAGATTTGGATGG + Intronic
907225093 1:52938710-52938732 AGGGAGAGGCTATATATGGAGGG - Intronic
907307267 1:53520311-53520333 AGGAGGAGGCAAGAGCTGCCAGG + Intronic
907358465 1:53895549-53895571 GGGGAGAAGGAAGTTCTGGCAGG - Intronic
909120389 1:71596017-71596039 AGGGAGGGGCAGGGTTTGGCAGG - Intronic
912580497 1:110716933-110716955 ACAGAGAGGCCAGATCAGGCAGG + Intergenic
913534079 1:119754863-119754885 AGGGATGGGCAAGATCTGTTTGG - Intronic
914921434 1:151850205-151850227 AGGGAGAGACAAGAGAGGGCAGG - Intronic
914944152 1:152048616-152048638 AGGGGGAGGGAGGAGCTGGCTGG + Intergenic
915037050 1:152936490-152936512 AGGGAGTGCTAAGATCAGGCAGG + Intergenic
917644738 1:177018838-177018860 AGGGAAAGTCAACCTCTGGCTGG + Intronic
918369150 1:183840988-183841010 AGAGAGAGGCAAGACATGGAGGG - Intronic
918428496 1:184434835-184434857 AGAGGGAGGCAAGGTCTTGCAGG + Intronic
919850949 1:201672023-201672045 AGAGAGAGGAAAGCTTTGGCAGG - Intronic
920571173 1:207019091-207019113 AGTGGGAAGCATGATCTGGCAGG - Exonic
921835393 1:219772829-219772851 GGGGAGGGGCAAGGTCTGGTAGG + Intronic
922185783 1:223273233-223273255 AGGGACAGGCCAGATCATGCAGG + Intronic
922368990 1:224890949-224890971 AGGAAGAGGAGAGATCAGGCTGG - Intergenic
923341941 1:233015123-233015145 AAGGAGAGGCATGGTCTAGCAGG + Intronic
1063179412 10:3584330-3584352 AGGGACAGGCAGGAGGTGGCAGG - Intergenic
1065485513 10:26233160-26233182 AGGTAGAGCCAAGATCAGACTGG + Intronic
1067208961 10:44242655-44242677 AGGCAGACGCAAGACCTCGCTGG - Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1069771459 10:70903209-70903231 AGGCAGAGGCAAGATTGGGCGGG + Intergenic
1070506376 10:77116942-77116964 AGGGAGAGGCCAAATCATGCAGG - Intronic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071837424 10:89432439-89432461 GGGCAGAGGCAAGGGCTGGCTGG + Exonic
1072124785 10:92436030-92436052 AGGGAAAAGCAAGATCTGGGTGG - Intergenic
1072605873 10:96982301-96982323 AGGGAGAGGCCACACCAGGCTGG - Exonic
1072689701 10:97563956-97563978 AGGAAGAGGAGAGATCAGGCTGG + Intronic
1073680614 10:105699395-105699417 AGGGAGAGACCAGAACTGGTAGG + Intergenic
1074982699 10:118632609-118632631 TGGGAGAGGCAGGATTTGCCAGG + Intergenic
1075213429 10:120511178-120511200 AGGAAGAGGCAAGTTGAGGCAGG + Intronic
1075575408 10:123573862-123573884 AGGCAGAGGCTGGATCTGTCAGG - Intergenic
1075718656 10:124572085-124572107 AGGGAGAGGCCAGGGCTGGCAGG + Intronic
1076603532 10:131674722-131674744 AGGCACAGGCATGATGTGGCAGG - Intergenic
1077005336 11:352622-352644 AGGGAGAGAAATGTTCTGGCTGG - Intergenic
1077315662 11:1918370-1918392 AGGGACAGGCAAGGTGTGCCTGG - Intergenic
1077550110 11:3196465-3196487 AGGGAGAAGCAAGGTCGTGCAGG - Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078476456 11:11634392-11634414 TGGTAGAGGCGAGATCTGGCAGG - Intergenic
1078899341 11:15627183-15627205 AGGGAGATGCAAGTGCTAGCTGG - Intergenic
1080804339 11:35638499-35638521 AGGGAGAGGCAGGAACTGGGAGG + Intergenic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081115366 11:39192918-39192940 AGGGAGAGGCACGGGCGGGCGGG - Intergenic
1082187619 11:49203908-49203930 AGGGAGAGGCCAGCTCTTGATGG + Intronic
1083244661 11:61417017-61417039 AGGGAGTGGCAGGAACTGGATGG + Intronic
1083691224 11:64409980-64410002 AGGGAGGGGGAAGAACAGGCGGG - Intergenic
1083723225 11:64614032-64614054 ATGAGGAGGCAAGAACTGGCTGG + Intronic
1084434663 11:69131909-69131931 AGGGAAAGGCAACAGCTGGTGGG - Intergenic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1084470867 11:69358323-69358345 GTTGAGAGGCAGGATCTGGCTGG + Intronic
1084472704 11:69372458-69372480 AGGTGGGGGCAAGATTTGGCAGG - Intergenic
1085531617 11:77195238-77195260 AGGGAGAGGCAGAGGCTGGCGGG - Intronic
1086453358 11:86938551-86938573 AGGAAGAGGAATGATGTGGCTGG + Intronic
1086678700 11:89641477-89641499 AGGGAGAGGCCAGCTCTTGATGG - Intergenic
1087136883 11:94730190-94730212 AGGCAGAGGTCAGATCTGGAAGG - Intronic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087235030 11:95708623-95708645 AAGGAGAAGCATGATCTAGCCGG + Intergenic
1088616105 11:111630311-111630333 AGGGAGAGGGGAGAACTGACTGG + Intronic
1088815961 11:113421109-113421131 AGGGAGAGGGAGTAGCTGGCTGG - Intronic
1088823265 11:113474540-113474562 GGGGAGAGGCAGATTCTGGCTGG - Intronic
1089254100 11:117185020-117185042 AGAGAGAGGCACCCTCTGGCTGG - Intronic
1089537712 11:119170837-119170859 GGGGAGAGGCAAGACGTGGCAGG + Intronic
1089554028 11:119305005-119305027 AGGGAGAGCAGAGATGTGGCAGG + Exonic
1089605784 11:119640462-119640484 AGGGAAAGGCAGGAGCTGGGAGG + Intronic
1089845184 11:121452640-121452662 AGGGAGAGGAAAAAACTGGAGGG - Intronic
1090447818 11:126779261-126779283 TGGGAGAGGTGAGATCTGTCGGG - Intronic
1091044432 11:132313049-132313071 AAAGAGAGGCAGGTTCTGGCCGG - Intronic
1091369116 11:135044221-135044243 AGGGGGAGGAAAGATCAGGGAGG - Intergenic
1092220257 12:6708303-6708325 AGGGAGAGGCATGAGCGAGCGGG + Intergenic
1092981913 12:13804098-13804120 AAGGAGAGGCAAAAGTTGGCAGG - Intronic
1093024592 12:14234346-14234368 AGGAAGAGGAGAGATCAGGCTGG - Intergenic
1093288616 12:17297279-17297301 AGGAAGAGGCTTTATCTGGCCGG - Intergenic
1095412194 12:41936485-41936507 AGGGAGGGGCAACATCTGGGAGG - Intergenic
1095957993 12:47817579-47817601 AGGGAGAGCCAAGCTGTGGAGGG + Intronic
1096694331 12:53339058-53339080 AGGGAGAGGCGCCATGTGGCAGG + Intronic
1097078690 12:56413532-56413554 AGGGAGAGCCAGGAACAGGCAGG - Intergenic
1097443320 12:59638249-59638271 AGGAAGGGGCAAGATCTTTCTGG + Intronic
1097633053 12:62087632-62087654 AGGGATAGGTAAGATGTGGTAGG + Intronic
1097906201 12:64922007-64922029 AGGGAGAGACAAGCTCTTGATGG - Intergenic
1097960147 12:65524297-65524319 AGGGAGAGCCCAGATCATGCAGG + Intergenic
1098617036 12:72539157-72539179 AGGGAGAGGTTATATCTGGAGGG - Intronic
1099334983 12:81344107-81344129 AGGGAAAGGCAAGACAAGGCAGG - Intronic
1099890523 12:88584100-88584122 AGGGAGAGGCGAGATCCTGGAGG - Intergenic
1100079637 12:90832546-90832568 AGGGAGAGACAAAAGGTGGCAGG + Intergenic
1100277016 12:93080705-93080727 AGGGAAAGGCAAGATGGGGGTGG + Intergenic
1101199496 12:102419749-102419771 GGGGAGAGGCAGGAGCTGGGTGG - Intronic
1101404117 12:104412994-104413016 AGGGAGACGCAAGTTCTGAGGGG + Intergenic
1102206737 12:111096144-111096166 AGGGAGAACCAAGAGCTGCCTGG + Intronic
1104219987 12:126773355-126773377 GGGGAGAGGGGAGATGTGGCAGG + Intergenic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1105387630 13:19946327-19946349 AAGGAGAGTCAAGAGCAGGCGGG - Intergenic
1105772792 13:23629247-23629269 TGGGAGAGGCAAGAACTCTCTGG + Intronic
1105892794 13:24694045-24694067 AGGGTGTGGCAAGACCTGGAGGG - Intronic
1105986534 13:25572718-25572740 AGGGAAAGGCAAGGGATGGCAGG - Intronic
1106409532 13:29501563-29501585 AGGGACAGGCGAGACCTGGATGG - Intronic
1108034181 13:46270814-46270836 ATGGGCAGGCCAGATCTGGCAGG - Intronic
1110614368 13:77524658-77524680 AGGGAGAGGGATGTTCTGACAGG + Intergenic
1112325976 13:98443086-98443108 AGGCCGGGGCTAGATCTGGCTGG - Intronic
1112343883 13:98575558-98575580 AGGGAGAGGGATGATCTCACTGG + Intronic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1112834775 13:103500910-103500932 TGGAAGAAGCAAGATCTTGCAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113576537 13:111399100-111399122 GGAGAGAGGCTAGATCAGGCTGG + Intergenic
1113914051 13:113860627-113860649 AGGGAGAGGCAAGGCCAGGGAGG + Intronic
1114318337 14:21526330-21526352 GGGGAGAGGGGAGATCTGGGAGG + Intronic
1117225460 14:53653885-53653907 AGGAAGAGGTAGAATCTGGCTGG + Intergenic
1118373828 14:65159667-65159689 AGGTTGAGGCAGAATCTGGCAGG + Intergenic
1118717243 14:68569182-68569204 AGGGAGAGCTAAGATCTCCCCGG + Intronic
1119071178 14:71586182-71586204 AGGGTGAGGCGAGCTCTGGCTGG - Intronic
1119202460 14:72766744-72766766 AAGGAGACCCAAGATCGGGCTGG - Intronic
1119646063 14:76349324-76349346 AGGGAAAGGCAAGATCTCAGTGG + Intronic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1120876919 14:89383589-89383611 AGGGAGTGCCAAGATCGGCCGGG - Intronic
1121888116 14:97563191-97563213 TGTTAGAGGCAAGACCTGGCAGG + Intergenic
1121897551 14:97662625-97662647 GGGGAGAGGGAAGAGCTGGTAGG - Intergenic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122627316 14:103091163-103091185 AGGGAGAGGCTTGACCAGGCTGG + Intergenic
1123157010 14:106236824-106236846 AGGGAGAGGCAAGTTCTTGTAGG + Intergenic
1123692404 15:22849445-22849467 AGGGAGAGGTCAGTTCTGGAAGG + Intronic
1123987538 15:25658647-25658669 AGTGAGAGGGAGGCTCTGGCTGG + Intergenic
1124458136 15:29863519-29863541 AGGCAGAGGCAAGCTCTCTCTGG + Intronic
1126550747 15:49926518-49926540 AGGGAGAGGGAAGCTATTGCAGG - Intronic
1126689221 15:51274965-51274987 AGGGAGAGCCCAGGTGTGGCTGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1130043348 15:80424516-80424538 AGAGAGAGGCAACATCTGACTGG - Intronic
1130657129 15:85799462-85799484 AGAGAGAGGCAACCCCTGGCAGG + Intergenic
1130937117 15:88480000-88480022 AGGGAGAGGGAAGAAATGCCTGG + Exonic
1131139433 15:89965138-89965160 AGGGAGAGGCATGACTTGGGGGG - Intergenic
1131450643 15:92536622-92536644 AGCGAGGGGCAAGAGCTGCCTGG - Intergenic
1131608739 15:93938411-93938433 AAGTAGAGGCAAGAATTGGCAGG + Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1133288110 16:4700436-4700458 AGGCAGAGGGAAGCTCTGGTTGG - Intronic
1135704483 16:24663124-24663146 AGGGAGTGGGAAGATGTGTCGGG + Intergenic
1137539039 16:49349549-49349571 AGTGAGAGCCAAGAGCTGGATGG + Intergenic
1137949197 16:52766684-52766706 AGGGAGAGGCTAGATCACACAGG - Intergenic
1138441389 16:57037120-57037142 AGGGAGGGGCTAGAGCTGGCTGG + Intronic
1138556788 16:57775567-57775589 AGTGAGAGCCAAGAGCAGGCAGG + Intronic
1139916059 16:70429123-70429145 AGGGAGATGCCAGAGCAGGCTGG + Intronic
1140096386 16:71879299-71879321 AGGGAGAGGGAACATCAGGTAGG - Intronic
1140228145 16:73095277-73095299 AGGGAGAGGCAAGATGGGTGTGG - Intergenic
1141812122 16:86382766-86382788 AGGCAGAGGGAGGAGCTGGCTGG - Intergenic
1141849462 16:86635332-86635354 ATGGAGAGGCAAGAAATAGCAGG + Intergenic
1143491604 17:7288382-7288404 AGGAGGAGGTAAGAGCTGGCTGG + Exonic
1143971819 17:10801399-10801421 AGACAGAGGCCAGATCTGGCAGG - Intergenic
1146311940 17:31776204-31776226 AGCAAGAGGCAAGATATGGCAGG + Intergenic
1146497904 17:33339245-33339267 CATGAGAGGCAAGATCTTGCAGG - Intronic
1146926314 17:36748211-36748233 AAGGAGTGGCAAGATGTGGTAGG + Intergenic
1147005756 17:37402429-37402451 AGGAAGATGCTAGATCTGGAAGG + Intronic
1147847855 17:43417812-43417834 TGGGAGAGCCAAGATGTGGGTGG + Intergenic
1148083050 17:44977926-44977948 TGGGAGAGGCACTAGCTGGCTGG + Intergenic
1148326734 17:46787544-46787566 TGAGAGAGACAAGCTCTGGCTGG - Intronic
1148497145 17:48059789-48059811 AGGAAGAGGCAGGCACTGGCTGG + Exonic
1148700407 17:49583343-49583365 AGGCAGAGGCAAGATGGGGTGGG + Intronic
1149061794 17:52431304-52431326 AGGCAGAGGCCAGACCTGGCTGG - Intergenic
1149798407 17:59543088-59543110 AGGGAGAGGCAACCTCTTGGTGG + Intergenic
1149967421 17:61179631-61179653 AGGGAGAGGCAAGAGATAGAGGG - Intronic
1150175564 17:63051076-63051098 AAGGAGTGGCATGATCTGACAGG - Intronic
1150218520 17:63483249-63483271 GAGGAGAGGCTAGAACTGGCTGG - Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151604117 17:75125456-75125478 AGGGAGAGGGAAGAACAGACAGG + Intronic
1152537635 17:80959876-80959898 AGGGAGAGGCAGGGGCTGGCAGG - Intronic
1153552252 18:6273811-6273833 AAGGAGAGGGAAGAGCTGGGAGG + Intronic
1154489182 18:14906225-14906247 AGGGAGAGGCAGAGACTGGCAGG - Intergenic
1154489358 18:14907762-14907784 AGGGGGAAGCCAGATCTGGAAGG - Intergenic
1155402708 18:25456680-25456702 AGGGAAAGGGAAGCTCTGGGAGG + Intergenic
1155897278 18:31346016-31346038 AGAGAAATGCAAGATCTGGGAGG + Exonic
1156163051 18:34383443-34383465 AGGGAATGGCCAGATGTGGCTGG - Intergenic
1157581305 18:48775745-48775767 AGGAAGAGGCAGGATCTGGGTGG + Intronic
1158945540 18:62444154-62444176 AGGGAGAGACAATCTCTGGATGG + Intergenic
1159384484 18:67706176-67706198 GGGGAGTGACATGATCTGGCTGG + Intergenic
1159396954 18:67871771-67871793 AGGGAGAGGTAGGATCTTACTGG - Intergenic
1159916154 18:74189529-74189551 ATAGAGAGGCAAGACCAGGCAGG - Intergenic
1159929645 18:74297504-74297526 AGGAAGAGGAGAGATCAGGCTGG - Intergenic
1160918354 19:1508226-1508248 AGGGAGGAGCAGGACCTGGCGGG + Intronic
1160990999 19:1860290-1860312 AGAGAGAGCCGAGAGCTGGCCGG + Intronic
1161907638 19:7169049-7169071 AGGGAGAGTCAGGTTTTGGCTGG - Intronic
1162824289 19:13242059-13242081 AGGGAGAGGCATGTCCTGGCAGG - Intronic
1162844624 19:13382710-13382732 AGGGAGCCGCAAGAGCAGGCTGG + Intronic
1163584683 19:18157289-18157311 GGGGAGAGGCAGATTCTGGCTGG - Intronic
1163663259 19:18590872-18590894 ATGGAGACGCCAGAGCTGGCGGG + Exonic
1163793001 19:19319264-19319286 AGGGAGGGGAACCATCTGGCGGG - Intronic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164502260 19:28829937-28829959 AGGGAAGGCCAAGAGCTGGCAGG - Intergenic
1164870569 19:31640081-31640103 AGGGAGAAGACGGATCTGGCTGG + Intergenic
1166452203 19:42911535-42911557 AGGGACAGGCAAGAGCTGATAGG + Intronic
1167655257 19:50759519-50759541 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167657059 19:50771750-50771772 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167749875 19:51373015-51373037 AGGGGGAGGGCAGATGTGGCTGG + Intergenic
1168409837 19:56132835-56132857 AGGAAGAGGATATATCTGGCCGG + Intronic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
926383908 2:12317299-12317321 AGGGAAAGGCAAGATAAGGATGG + Intergenic
926386674 2:12342225-12342247 AGGCAGAGGCAAAATCTTGGAGG - Intergenic
927296150 2:21455397-21455419 ATGCAGAGGCAAGAATTGGCTGG + Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
927712090 2:25332355-25332377 AGGGGGAGAGAAGATCTGGAAGG - Intronic
927862851 2:26570925-26570947 AGGGAGAGGTCAGATGTGGAGGG + Intronic
929118602 2:38465495-38465517 AGAGACAGGCAAGAAGTGGCAGG - Intergenic
930058842 2:47272317-47272339 AGGGTGTGGCGAGATCTGGACGG + Intergenic
930147759 2:48024888-48024910 AAGGAGAGGCCAGAACGGGCTGG + Intergenic
930253619 2:49064173-49064195 AGGGAGAGGGAAGAGCATGCTGG + Intronic
932176458 2:69607265-69607287 AGGGAGAGGGAAGGACGGGCAGG + Intronic
935310785 2:101781338-101781360 AGGGGGAGGGAAGATCTGGCTGG - Intronic
936619730 2:114082916-114082938 AGAGTGAGGCAGGATTTGGCTGG - Intergenic
937031828 2:118747250-118747272 AGGAGGAGGCAGGATCTGCCTGG + Intergenic
937304586 2:120863338-120863360 AGGAAGAGGCAAGCACTGACTGG - Intronic
937499435 2:122462220-122462242 AGGGAGAGGCCATATCTTGATGG + Intergenic
938386131 2:130868609-130868631 AGGGAGAGGCCAGGTCAGGCAGG + Intronic
938824763 2:134993742-134993764 ATGTAGAGGCAAGATCTTTCTGG + Intronic
939850222 2:147295556-147295578 AGGTAGATGCAAAATCTGGATGG - Intergenic
940362043 2:152806026-152806048 AGTGAAAGGCAAGATCTGTCTGG + Intergenic
941004065 2:160229522-160229544 AAGGACAGGCAAGATTTGGGTGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941970207 2:171341932-171341954 AGGGAGAGGAAAGGAGTGGCTGG + Intronic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944429451 2:199617406-199617428 AGGGAAAGGAAAGCACTGGCAGG - Intergenic
945158764 2:206866777-206866799 AGGGACCGGGAACATCTGGCAGG - Intergenic
945869854 2:215215293-215215315 AGGGAGAGGGAAAATCAGGGTGG + Intergenic
946033746 2:216725371-216725393 AGGCAGAGAAAAGATATGGCGGG + Intergenic
946460689 2:219865904-219865926 AAGCAGAGGCTAGATCTTGCAGG - Intergenic
947101088 2:226621913-226621935 AGGGAGAGGCATGGTGTGACAGG - Intergenic
947666488 2:231909132-231909154 GAGGAGGGGCAAGATGTGGCTGG + Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
947752171 2:232538848-232538870 AGGGAGGGGGAAGCTCTGGGAGG + Intergenic
948646101 2:239406138-239406160 AGGGAGTGGCTAGAAATGGCAGG + Intergenic
1168860790 20:1044660-1044682 AGGGAGAGGAAAAAGCTGCCAGG - Intergenic
1169252996 20:4074427-4074449 GGGGTGAGGCACAATCTGGCTGG + Intronic
1169334993 20:4748663-4748685 AGGGAAAGGCAAGACCTGGCTGG + Intergenic
1169673935 20:8133021-8133043 AGGGAGGGGCAAGCTTTGCCTGG + Intronic
1170185341 20:13583257-13583279 AGGCAGAGGCAAGCTCAGGCTGG - Intronic
1171410338 20:24942939-24942961 AGGGAGAGGCAAGACCTCAGGGG - Intergenic
1172008967 20:31835473-31835495 AGGTGGAGGCCAGGTCTGGCAGG + Intergenic
1172443921 20:34983510-34983532 AGGGAGAGGCCAGAGCTGGCAGG + Intronic
1172634158 20:36398445-36398467 AGGGTGAGGTAAGATCAGTCTGG + Intronic
1172826120 20:37787920-37787942 AGGCAGAGGCCAGATCTTGAGGG - Intronic
1172843190 20:37914561-37914583 AGGGAGAGAAAAGGTCTGGAAGG - Intronic
1173858812 20:46268684-46268706 GGGGAGAGGCCAGAGATGGCAGG + Intronic
1174378744 20:50143040-50143062 GGGGAGTGGCATGATCTGCCTGG + Intronic
1174410098 20:50329753-50329775 AATGATAGGCTAGATCTGGCAGG - Intergenic
1174799661 20:53552797-53552819 TGGTAGAGGCAAGATTTGCCAGG + Intergenic
1175337611 20:58206387-58206409 AGGAACAGGGAAAATCTGGCAGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175661763 20:60819625-60819647 AGGGGGAGGCGTGATCTTGCTGG + Intergenic
1177256905 21:18675738-18675760 AGGGAGAGAAAATATCTGACAGG + Intergenic
1179468258 21:41592798-41592820 AGGGAGATGGAAGATATGGTCGG - Intergenic
1179635054 21:42703452-42703474 AGGAAGAGGCAAAGGCTGGCCGG + Intronic
1180159673 21:45993417-45993439 AGGGAGAGCCAGGGCCTGGCGGG + Intronic
1182048476 22:27295521-27295543 AGACAGAGGGAAGAACTGGCAGG - Intergenic
1183323685 22:37180221-37180243 AGGCAGGGGCAGGATCAGGCAGG + Exonic
1183401114 22:37605238-37605260 AGGGACATGCAGGATCTGACTGG + Intergenic
1184644075 22:45886593-45886615 AGAGAGAGGGAAGAACTGCCGGG - Intergenic
1184982663 22:48105356-48105378 GGGGAGAGGAAAGATGGGGCAGG + Intergenic
949645419 3:6088136-6088158 AGGCAGAGGCTAGATCTTGAAGG + Intergenic
950133568 3:10564500-10564522 AGGGGGAGACAAGATCAGCCTGG - Intronic
950467312 3:13163044-13163066 AGTGAGAGGCAGGGTCTCGCAGG - Intergenic
950572469 3:13809987-13810009 AGGGAGAGACAGGAGCTGGTGGG + Intergenic
952261081 3:31741088-31741110 AGGAAGAGGAAAGACCTTGCAGG - Intronic
952278061 3:31896756-31896778 AGGCATAGGCAGGAGCTGGCTGG - Intronic
953434597 3:42868461-42868483 AGGGTGAGGGAATACCTGGCTGG - Intronic
953500100 3:43424902-43424924 AGGGAGAGGCAGGCTCAGACAGG + Intronic
953840853 3:46389256-46389278 AGGAAGAGGAGAGATCAGGCTGG + Intergenic
955401254 3:58593149-58593171 AGGAAGAGGAGAGATCAGGCTGG - Intronic
956741932 3:72281948-72281970 AGGGAGAAGCAACATCTGCGAGG - Intergenic
958799886 3:98743464-98743486 AGGGAGGGGCATTATCTGGGAGG - Intronic
959783683 3:110267451-110267473 AGGGGGAGGCAAGGCCAGGCGGG - Intergenic
960964385 3:123094768-123094790 TGAGGGAGGCAAGCTCTGGCTGG - Intronic
961633905 3:128321141-128321163 TGGGAGAGGCAGGGTCAGGCAGG + Intronic
961835703 3:129657089-129657111 AGGGAAAGGTTATATCTGGCAGG + Intronic
963412487 3:144948138-144948160 AGGGAGAGACAAGCTCTTGATGG - Intergenic
963627425 3:147690817-147690839 AGGGAGAGGAAAGATTTTGATGG - Intergenic
966623504 3:181991740-181991762 AGGGAGGGGCAACATCTAACTGG + Intergenic
967224101 3:187274855-187274877 AGGGAGAAGAAAGAGCTGGCAGG + Intronic
967315624 3:188149855-188149877 AGGGAGAGGTAAGATGTGCTTGG + Intergenic
967888199 3:194347213-194347235 AGGGATAGGGAAGGTTTGGCTGG + Intronic
969798736 4:9545894-9545916 AGGGAGAGGGAAAATCTTTCAGG - Intergenic
970113880 4:12670988-12671010 AGGGAGTGGCAAGTGCTGGAAGG + Intergenic
970232456 4:13924963-13924985 TGGGAGTGGTAAGATCTTGCAGG + Intergenic
970627339 4:17902148-17902170 AGAGAGACACAAGATGTGGCTGG + Intronic
972441973 4:39103134-39103156 AGGCAGAGGCTAGATCATGCAGG + Intronic
972668860 4:41194954-41194976 AGGGAGAGGTATGATCTGCTGGG - Intronic
973051863 4:45608158-45608180 AGGGAGAGGTAAGTGCTGGGAGG - Intergenic
975857571 4:78640956-78640978 GGAGAGAGGCAAGATATGCCAGG - Intergenic
976199531 4:82564536-82564558 AGGTAGAAGCAAGTGCTGGCTGG - Intergenic
977705288 4:100063984-100064006 AGGCACAAGCAAGATCAGGCAGG + Intergenic
978056647 4:104277398-104277420 AGGGAGAGGAAGGAACTGGAGGG + Intergenic
978417233 4:108489283-108489305 AGGGAGAGACCAGAACTGCCGGG - Intergenic
981546816 4:145902417-145902439 AGGGAAAGGAAGGAGCTGGCCGG + Exonic
982228319 4:153185832-153185854 AGGGAGAGAGAAGCCCTGGCAGG - Intronic
982319334 4:154062222-154062244 AGGAAGAGGAGAGATCAGGCTGG - Intergenic
984189799 4:176592101-176592123 AGGGAGAGGCAATATCCCTCAGG + Intergenic
984648033 4:182240679-182240701 AGGGAAAGGCAGGATCTAGCAGG + Intronic
984821436 4:183886046-183886068 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821453 4:183886150-183886172 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821461 4:183886202-183886224 AGGCAGATGCAAGATCAGGAAGG + Intronic
984821469 4:183886254-183886276 AGGCAGATGCAAGATCAGGAGGG + Intronic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
987037027 5:14029448-14029470 AGGGCAAGGAAAAATCTGGCTGG - Intergenic
990564769 5:57018022-57018044 AGGAAGAGGAGAGATCAGGCTGG + Intergenic
990717136 5:58649675-58649697 AGGGAGAGACAAGAGCTTGTCGG - Intronic
990980444 5:61598223-61598245 AGGGAGAGGCAAGCTCTGTGGGG + Intergenic
992662487 5:78975152-78975174 AGGGAGAGGCGACCACTGGCAGG + Intronic
994040291 5:95251389-95251411 AGGCAGAGGCCAGATCATGCAGG + Intronic
994420567 5:99524142-99524164 CGGGAGTGGGAAGATGTGGCAGG + Intergenic
994484106 5:100373931-100373953 AGAGAGAGGCATGACATGGCAGG - Intergenic
994486809 5:100391810-100391832 CGGGAGTGGGAAGATGTGGCAGG - Intergenic
996094202 5:119381204-119381226 AGGGAGAGGATAGATATAGCAGG - Intronic
997362548 5:133304436-133304458 AGGGAGAGGCAGGAACGGGGTGG - Intronic
998447798 5:142211788-142211810 AGGGAGAGGCTATATCTGGGTGG - Intergenic
999185777 5:149707518-149707540 TGAGAAAAGCAAGATCTGGCTGG + Intergenic
999194085 5:149770199-149770221 CTGAAGAGGCCAGATCTGGCAGG - Intronic
999203516 5:149832844-149832866 GGGGAGAGGCTGGAGCTGGCTGG - Exonic
999249794 5:150175787-150175809 TGGGAGTGGGGAGATCTGGCCGG - Intronic
999420301 5:151435933-151435955 AGGGATAGGAAAGATTTAGCAGG + Intergenic
1000191572 5:158915980-158916002 ATGAAAAGGCAAGATCTGTCAGG - Intronic
1001506212 5:172283171-172283193 AGGGTGCGGAAAGATGTGGCGGG + Intronic
1002783638 6:385026-385048 AGGGAGAGCCAAGAGGTGCCCGG - Intergenic
1003301708 6:4889913-4889935 AGGGAGGGACAGGATCTGCCTGG + Intronic
1005786041 6:29247023-29247045 AGGAAGAGGAGAGATCTGGCTGG + Intergenic
1006073782 6:31516259-31516281 AGAGAGGGGCAGGATCTGGATGG - Intergenic
1006337612 6:33428555-33428577 AGGCAGAGGCAAGATAAGACAGG - Intronic
1006425246 6:33959394-33959416 TGGGAGAGGCCAGAACTGCCTGG - Intergenic
1007128151 6:39445010-39445032 GGGGAAAGTGAAGATCTGGCTGG + Intronic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1009790733 6:68399110-68399132 AGGTTGAGGCTAGATCTAGCTGG + Intergenic
1010320373 6:74501770-74501792 AGAGAAAGATAAGATCTGGCCGG + Intergenic
1012282069 6:97339764-97339786 AAGGAGAAGCAAGATCTCTCAGG - Intergenic
1015214172 6:130731102-130731124 AGGGAGAGGTAAGATCAGAGTGG - Intergenic
1015529845 6:134210720-134210742 AGGCTGAGGCAAAATCTGGGAGG + Intronic
1017524448 6:155230279-155230301 ACAGAGAGGCAGGGTCTGGCAGG - Intronic
1017708435 6:157146054-157146076 GGGGAGAGGCTGGGTCTGGCAGG - Intronic
1017864997 6:158435465-158435487 AGGAGGAGGCAAGATCCAGCTGG - Intronic
1019450900 7:1097279-1097301 AGGGAGAGACAAGATGAGCCTGG + Intronic
1020137207 7:5594054-5594076 GGGGAGAGCCAAGATTGGGCGGG - Intronic
1021926751 7:25541217-25541239 AGGGTGAGGAAAGAGCTGGCAGG - Intergenic
1021978505 7:26031678-26031700 AGGGAGTGGTAAGATCTGACTGG + Intergenic
1022471463 7:30684070-30684092 AGGCAGAGGGTAGACCTGGCTGG - Intronic
1022535158 7:31093898-31093920 AGGGAGAGGCAAGAACTGCTCGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023274720 7:38506053-38506075 GGGGAGAGGAAAGAAATGGCAGG - Intronic
1024978288 7:55133703-55133725 AGGGAGAGGCCAGCTCTGCTGGG + Intronic
1026216472 7:68353794-68353816 AGGGACAGTCAAGATAAGGCAGG + Intergenic
1026332840 7:69367896-69367918 TGGGAGCGGCAGGATCTGTCTGG - Intergenic
1026355359 7:69552640-69552662 AGGAAGAGGCCAGATCCTGCAGG + Intergenic
1031873927 7:127116688-127116710 AGTGAGAGGCAATCTGTGGCTGG - Intronic
1032864873 7:135915332-135915354 AGGGAGAGGCAAGTGCAGGCTGG + Intergenic
1033772533 7:144568340-144568362 AGTTAGAGACAAGATGTGGCTGG - Intronic
1033882390 7:145902089-145902111 AGGGAAAGACAGGGTCTGGCTGG - Intergenic
1034429521 7:151034190-151034212 AGGAAGGGCCAAGATCTGGCTGG + Intronic
1037643828 8:20772341-20772363 AGGCAGAGGCCAGTTCTGGCTGG + Intergenic
1039131803 8:34273364-34273386 AGGGAGACAGAAGACCTGGCTGG - Intergenic
1040364280 8:46699008-46699030 AAGGTGAGGCAAGAACTGGAAGG - Intergenic
1040385359 8:46911620-46911642 AGGGAGAGCCAAGCACTGACAGG + Intergenic
1040572980 8:48625752-48625774 AGGGAGGGAGAAGGTCTGGCTGG - Intergenic
1041871691 8:62641679-62641701 AGTGAGAGGCAAGATTAGGAAGG + Intronic
1043721320 8:83549076-83549098 AGGAAGAGGAGAGATCAGGCTGG - Intergenic
1043919808 8:85968446-85968468 AGGTAGAGGCAAGGTCTTTCAGG + Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1045008673 8:97938019-97938041 AGGCAGAGAAAATATCTGGCGGG - Intronic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1045734113 8:105275197-105275219 AGGGAGAGGAAAGTTGGGGCGGG - Intronic
1047557658 8:125950195-125950217 TGGGAGAGGAAAGGTCTGGCAGG + Intergenic
1048491289 8:134896143-134896165 AGGCAGAGGCAAGAGTTGTCTGG - Intergenic
1049269822 8:141688792-141688814 AGGGAGAGGCAAGCTGTGAGTGG + Intergenic
1049346496 8:142142000-142142022 AGGAAGAAGCGAGAACTGGCAGG - Intergenic
1049587116 8:143437322-143437344 TGGGAGAGGCAAGGCCTGGAGGG - Intergenic
1051870883 9:21736201-21736223 AGGGAGAGGAGAGACTTGGCTGG + Intergenic
1052742703 9:32409138-32409160 AAGGACAGGTAAGATTTGGCAGG - Intronic
1052915783 9:33923510-33923532 AGGAAGAGGCAAGCTGAGGCTGG + Intronic
1053078177 9:35152734-35152756 AGGAAGAGGAGAGATCAGGCTGG + Intergenic
1055014603 9:71602623-71602645 AGGGAAAGGCAAGATGGGGAGGG - Intergenic
1055397882 9:75892573-75892595 AGGGAGAGGGAGGTGCTGGCTGG + Intronic
1055542519 9:77326931-77326953 ATGGAGAGGCAAGAGCTGTACGG - Intronic
1058844223 9:108939876-108939898 ATGGGCAGGCCAGATCTGGCAGG - Exonic
1060624170 9:125095286-125095308 GGGAAGAAGCAAGATTTGGCAGG - Intronic
1060992889 9:127858756-127858778 AGAAAGTGGAAAGATCTGGCTGG - Intergenic
1061002679 9:127911167-127911189 AGGCAGAGGCAGGATCACGCAGG + Intronic
1061132212 9:128714506-128714528 AGGCAGACGCAAGAGCTGGCAGG - Intronic
1061262981 9:129490152-129490174 AGGGAGAGGCAGGGGCTGGGAGG - Intergenic
1061617814 9:131791864-131791886 AGGGAGAGGCAGGAGCCTGCGGG + Intergenic
1186117927 X:6324733-6324755 AGGAAGAGGAAAAATCTGGAAGG - Intergenic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1187704259 X:21993833-21993855 AGGGAGAGAGAAGAACTAGCAGG - Intronic
1189873032 X:45404433-45404455 AGTGAGCTGGAAGATCTGGCAGG - Intergenic
1190690166 X:52907380-52907402 TGGGAGAGGCACGGCCTGGCTGG - Exonic
1190695817 X:52948412-52948434 TGGGAGAGGCACGGCCTGGCTGG + Exonic
1191690099 X:63930554-63930576 AGAGAGAGGAAAGAGCTAGCTGG + Intergenic
1192763988 X:74124272-74124294 AGGAAGAGGAGAGATCAGGCTGG + Intergenic
1192935781 X:75857543-75857565 AGGAAGAGGGGAGATCAGGCTGG + Intergenic
1194641183 X:96405911-96405933 AGGGAAAGGCAAGATAGGGAAGG - Intergenic
1197173134 X:123456564-123456586 AGGGAGGGGTAAGGTGTGGCTGG - Intronic
1197717333 X:129718968-129718990 AGGGAGAGGATGGCTCTGGCAGG - Intergenic
1197747915 X:129945304-129945326 AGGGAGAGATAGCATCTGGCTGG - Intergenic
1198073190 X:133169825-133169847 AGGGAAAGGCAAGATGGGGGTGG - Intergenic
1198675146 X:139123329-139123351 AGGCAGAGGCCAGATCTTGTAGG - Intronic