ID: 1104647889

View in Genome Browser
Species Human (GRCh38)
Location 12:130509865-130509887
Sequence GCAGCCCAGAAGCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104647886_1104647889 12 Left 1104647886 12:130509830-130509852 CCTGATGGGTAAAATCTCCAAAG 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248
1104647885_1104647889 13 Left 1104647885 12:130509829-130509851 CCCTGATGGGTAAAATCTCCAAA 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248
1104647888_1104647889 -5 Left 1104647888 12:130509847-130509869 CCAAAGGAAAAAACATTAGCAGC 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104647889 Original CRISPR GCAGCCCAGAAGCACCATGA TGG Intronic