ID: 1104647889

View in Genome Browser
Species Human (GRCh38)
Location 12:130509865-130509887
Sequence GCAGCCCAGAAGCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104647886_1104647889 12 Left 1104647886 12:130509830-130509852 CCTGATGGGTAAAATCTCCAAAG 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248
1104647885_1104647889 13 Left 1104647885 12:130509829-130509851 CCCTGATGGGTAAAATCTCCAAA 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248
1104647888_1104647889 -5 Left 1104647888 12:130509847-130509869 CCAAAGGAAAAAACATTAGCAGC 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG 0: 1
1: 0
2: 5
3: 31
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104647889 Original CRISPR GCAGCCCAGAAGCACCATGA TGG Intronic
901274754 1:7982441-7982463 GCACCCCATCAGCACCAGGAAGG - Intronic
901694020 1:10993136-10993158 CCAGCTCAGAAGCGCCAGGATGG - Intergenic
902055989 1:13600820-13600842 GTAGCCCACAAGCAGAATGAGGG + Intronic
902510642 1:16965318-16965340 CCCGACCAGGAGCACCATGAGGG - Intronic
903568232 1:24285011-24285033 CCAGCCCAGGAGCCCCATGGGGG + Intergenic
903899780 1:26635371-26635393 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
903920253 1:26794911-26794933 ACATCCCAGAAGCACCAAGGCGG - Exonic
904856131 1:33499510-33499532 GCAGGCCAAGAGCCCCATGATGG - Intergenic
905033484 1:34902818-34902840 GCAGCCCTGAAGCAGCAGCAGGG + Intronic
909099926 1:71337387-71337409 GCAGCTCAGAAGAAACAAGAGGG - Intergenic
909364455 1:74803033-74803055 GCAGACCTGAACCACCATGCCGG + Intergenic
910041093 1:82852196-82852218 GCAGCCAAGGAGTATCATGATGG + Intergenic
910201457 1:84704616-84704638 ACAGCCCAGAGGCTCCTTGAGGG - Intergenic
910626664 1:89314576-89314598 GCAGCTCAGAAGGAACAAGAGGG - Intergenic
910730596 1:90391817-90391839 GCAGCCCAGAGGCCCCAGGTTGG + Intergenic
910897103 1:92080600-92080622 GGACCCCAGAAGTACCATGGGGG - Exonic
911063932 1:93770834-93770856 GCAGCACAGGAGCACCATTTTGG + Intronic
915713328 1:157921946-157921968 GAAGCCCAGAAGGCCCATGTAGG - Intergenic
917310646 1:173674316-173674338 CCATCCCAAAAGAACCATGAAGG - Intergenic
919764925 1:201120866-201120888 GCTGCCCAAAAGCAGCATTATGG - Intronic
920254157 1:204642993-204643015 GCAGCCCACCCACACCATGACGG + Intronic
921158591 1:212456926-212456948 GCACAGCAGAAACACCATGATGG + Intergenic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
922780759 1:228250494-228250516 GAAGCCAAGGAGCACCAGGAAGG - Intronic
923598597 1:235381196-235381218 GCAGCTCAGAAGAAACAAGAGGG - Intronic
924810110 1:247393367-247393389 GCTGACCAGAAGCAAGATGATGG + Intergenic
1062972499 10:1659832-1659854 TGAACCCAGAAGCAGCATGATGG - Intronic
1062972529 10:1659953-1659975 TGAACCCAGAAGCAGCATGATGG - Intronic
1063326635 10:5110098-5110120 GCAGCCCAGAAGCTCCAACTGGG + Intronic
1063911467 10:10834841-10834863 GCATCGGACAAGCACCATGAAGG - Intergenic
1064034076 10:11901385-11901407 GCAGCCCAGAAACAGCAGGGGGG + Intergenic
1066043810 10:31579264-31579286 CCTGCCCAGAATCACCATGATGG + Intergenic
1066540149 10:36437782-36437804 GCAGACCAGAAGCACCCTGAGGG + Intergenic
1067264366 10:44724592-44724614 GCAGCCCTGAAACTCCATGCTGG + Intergenic
1067810833 10:49426013-49426035 GCAGCCCAGGCTCACCAAGACGG + Intergenic
1069790031 10:71013558-71013580 GCAACTCAGAATCACCATGAAGG + Intergenic
1070147704 10:73786612-73786634 TGATCCCAGAAGCACCAAGAAGG + Intronic
1072784548 10:98270751-98270773 GAAGCCGTGAAGCACCATGCAGG + Intergenic
1073040455 10:100600815-100600837 GCAGTCCAGAAGAACTAAGATGG - Intergenic
1073290358 10:102410421-102410443 GCAGCGCAGCAGCACCGGGAAGG + Intronic
1073317968 10:102596196-102596218 TCAGCCCAGAAGCCCCATGTGGG - Intronic
1074562119 10:114544043-114544065 ACAGCCCAGAAACACCATGGTGG + Intronic
1075423594 10:122324818-122324840 GAAGCCAAGAAGCAACATGGCGG - Intronic
1076484282 10:130805841-130805863 GAAGCCAAGGAGCACCAGGAGGG + Intergenic
1076521750 10:131085586-131085608 GCCGACCAGACGCACCCTGAGGG + Intergenic
1076624906 10:131815848-131815870 AGAGCCCAGGAGCACCAGGAGGG + Intergenic
1076899243 10:133328972-133328994 GCAGCCCAGCTTCACCATGGTGG + Exonic
1077380583 11:2235169-2235191 GCAGCCCAGGAGGCCCCTGAAGG + Intergenic
1078904809 11:15673750-15673772 TCAGCCAAGAAGCAACATGGTGG + Intergenic
1078924881 11:15865558-15865580 GAAGGCCAGAGGCACCATAAAGG - Intergenic
1079235953 11:18690471-18690493 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
1080413703 11:32050108-32050130 GCAGACCAGAACCCCCATGGAGG - Intronic
1080647730 11:34199012-34199034 GATTCCCAGAAGCAGCATGAAGG - Intronic
1081485207 11:43522063-43522085 GCAGTCCAGCAGCACCATCGGGG - Intergenic
1081808222 11:45901321-45901343 GCAGCCCAGGAGATCCAGGAAGG + Intronic
1081894671 11:46575132-46575154 GCAGCCCAAAAGGACTAAGAGGG - Intronic
1083282208 11:61634062-61634084 GCAGTGCAGTAGCACCATCACGG - Intergenic
1085732785 11:79013525-79013547 GCAGCCCAGCAGCCCAATCATGG + Intronic
1086131794 11:83408987-83409009 GCAGCCCAGAAGCACCAGCCAGG - Intergenic
1086770092 11:90751702-90751724 GCAGAGCTGAAGCTCCATGAAGG - Intergenic
1090246917 11:125222983-125223005 GCAGCCTGGAACCACCAAGAAGG + Intronic
1090742866 11:129682047-129682069 GCAGCCCAAATGGACCATGACGG + Intergenic
1091681465 12:2530519-2530541 CAAGGCCAGAAGGACCATGATGG + Intronic
1091696855 12:2633468-2633490 GGAGCCCAGGAGCACCAGCAAGG - Intronic
1092125959 12:6075250-6075272 ACAGCCCCGAAGCACCCTAAGGG + Intronic
1092148737 12:6232659-6232681 GAAGCCCACCAGCATCATGAGGG - Exonic
1092653468 12:10659990-10660012 GCAGCTCAGAAGAAACAAGATGG + Intronic
1095339655 12:41074621-41074643 ACTGCGCAGAAGCAGCATGAGGG + Intergenic
1096558467 12:52418756-52418778 GCAGCCCAGAAGCAGCTCCACGG - Intergenic
1097578171 12:61420625-61420647 GCAGCCCAGAAGCTCCAACTAGG - Intergenic
1098296768 12:69011885-69011907 GCAGCCATGAAGCCCCATTATGG - Intergenic
1098496326 12:71139759-71139781 GAAGCCCAGAATCATGATGATGG + Exonic
1101088509 12:101260428-101260450 GCAGGCCAGGAGCACCAGAAAGG + Intergenic
1102455223 12:113066768-113066790 CCAGAACAGAAGCACCTTGAGGG - Intronic
1104579702 12:130001942-130001964 ACAGCCCAGTAGCATCATCAAGG + Intergenic
1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG + Intronic
1105946735 13:25196818-25196840 GCTGGCCAGAAGGACCATGAAGG + Intergenic
1106076354 13:26464496-26464518 GCAGCCCAGAAGCAGAAGCAGGG - Intergenic
1107311743 13:39085916-39085938 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
1109346141 13:61116886-61116908 GCAGCTCAGAAGGAACAAGAGGG + Intergenic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1114155994 14:20104129-20104151 GCAGCCCAGAAGCTCCAACTGGG + Intergenic
1114501580 14:23173238-23173260 GCAGAGCAGAAGCTGCATGAGGG + Intronic
1114565239 14:23627025-23627047 GCAGCTCAGAAGAAACAAGAAGG + Intergenic
1114605624 14:23993817-23993839 GCTGCCCAGGAGAGCCATGATGG - Intronic
1114611129 14:24041462-24041484 GCTGCCCAGGAGAGCCATGATGG - Intergenic
1115041022 14:28927968-28927990 GCAGCCCCAATTCACCATGATGG - Intergenic
1115397454 14:32924491-32924513 GCAGGACAGAAGTACCAGGAGGG - Intergenic
1115742173 14:36399832-36399854 GCAGCCCTGGGGCACCATGCTGG + Intergenic
1117288577 14:54310619-54310641 GCAGCCCAGATGTACTGTGAGGG - Intergenic
1119484484 14:74978766-74978788 GGAGCCCAGAAGCCCCAGCAAGG - Intergenic
1121462273 14:94090197-94090219 GCAGCTCAGAAGAAACAAGAGGG - Intronic
1122179901 14:99947311-99947333 GCAGCCCTGAAGCACCGGGAGGG + Intergenic
1124146762 15:27134870-27134892 GCAACACAGAAGCTCCAGGAAGG - Intronic
1124486855 15:30125297-30125319 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124541937 15:30594274-30594296 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124548587 15:30656065-30656087 CCAGCCCAGAAGATCCATGAAGG - Intronic
1124756670 15:32413026-32413048 CCAGCCCAGAAGATCCATGAAGG + Intergenic
1127384500 15:58456521-58456543 GCAGCCCAGAGGCCCCTGGAGGG + Intronic
1127540487 15:59933749-59933771 GCATTGCTGAAGCACCATGAGGG - Intergenic
1128846585 15:70902749-70902771 GCAGCCTATCAGCACCAAGAAGG + Intronic
1130736211 15:86552640-86552662 GAAGCCTAGAAGTTCCATGAGGG - Intronic
1130926068 15:88386759-88386781 GCAGCCCAAAGGGATCATGAGGG + Intergenic
1131379223 15:91949954-91949976 GGAGTGCAGTAGCACCATGAGGG - Intronic
1132298247 15:100760343-100760365 TCAGCCCAGAAACATCATGGGGG + Intergenic
1133113160 16:3561740-3561762 GCTGCCCAGCAGCTCCATCACGG + Exonic
1133466715 16:6034478-6034500 GCAGCCAGGAAGCACCATCTTGG - Intronic
1134046961 16:11108140-11108162 GCTGGTCTGAAGCACCATGAGGG + Intronic
1134271986 16:12740840-12740862 GCAGCCCAGCAGCACCCTCCCGG - Intronic
1134290957 16:12902549-12902571 GATGCCCACGAGCACCATGACGG - Exonic
1134855225 16:17513106-17513128 GCAGCTGAGAAAGACCATGAAGG - Intergenic
1135502820 16:23012054-23012076 CCAGACCATAAGCTCCATGAGGG + Intergenic
1135920357 16:26643891-26643913 TCAGACCAGAAGCACCAACAGGG - Intergenic
1136630355 16:31486231-31486253 GATGCCCAGAAGCGCGATGACGG - Exonic
1137577285 16:49608663-49608685 GCAACCCAGAAACACCAACAAGG + Intronic
1139309616 16:66017527-66017549 GTAGCTGAGAAGCAACATGAAGG + Intergenic
1141268887 16:82521326-82521348 CCAGCCCAGGAGAACCATGCAGG - Intergenic
1141607540 16:85163330-85163352 GCAACCGAGAAGTGCCATGAGGG - Intergenic
1141607551 16:85163391-85163413 GCAACCGAGAAGTGCCATGAGGG - Intergenic
1142404635 16:89880960-89880982 CCATCCCAGCAGCACCATGATGG - Intronic
1142490333 17:274391-274413 GCAGCCCTGAAGTGCCAGGAAGG - Intronic
1142507119 17:371470-371492 CCTGCACAGAAGCACCGTGAGGG - Intronic
1142992977 17:3744059-3744081 GGAGGGCAGCAGCACCATGATGG + Intronic
1143534159 17:7525852-7525874 GCAGCTCAGAAACAACAAGAGGG - Intergenic
1143998270 17:11027993-11028015 CCAACCCAGAAACACCGTGAAGG + Intergenic
1145235981 17:21208711-21208733 GCAGGCCTGAAGCTCCATGAGGG + Intronic
1146184073 17:30713577-30713599 GTGGCCCAGAAAGACCATGAAGG - Intergenic
1146305475 17:31726790-31726812 GCAGCCCTGTAGCTCCATGAAGG - Intergenic
1149616058 17:58000231-58000253 GCTACCAAGAAGCACCGTGAAGG + Intronic
1149658067 17:58320550-58320572 GAAGCCCAGAGGGAACATGAAGG - Exonic
1151585649 17:75006800-75006822 GATGCCCTGAAGGACCATGAGGG + Intergenic
1151653758 17:75485953-75485975 GCAGCCCAGCAGCAGCAGCACGG - Exonic
1152655585 17:81517825-81517847 GCAGCTAAGAACCACCCTGAGGG - Intronic
1156042894 18:32843409-32843431 CCAGCCCAGAAGCATCTTGTGGG - Intergenic
1157513607 18:48295810-48295832 TCAGCCCAGCAGCAGCAGGAGGG + Intronic
1157768347 18:50322311-50322333 GAAGTGCAGAAGCACCATCAGGG + Intergenic
1158174361 18:54637504-54637526 GCAGCACTGATGCACCATTAGGG - Intergenic
1159835979 18:73336000-73336022 GCAGCCCAGAAGCCACATGGAGG + Intergenic
1160340208 18:78083070-78083092 TCAGCCCAGCAGGAGCATGAAGG - Intergenic
1161400067 19:4063333-4063355 GCAGCCCAGATGCTCCAAGGAGG - Intronic
1162087153 19:8255732-8255754 GCACCCCAGAAGCCCCATCCTGG - Intronic
1164053523 19:21603421-21603443 GCATCCAAGACGCACCATGAGGG + Intergenic
1164942986 19:32266022-32266044 CCAGCTCAGAAACACCATGAGGG + Intergenic
1165176885 19:33936732-33936754 ACATCCCAGAAGCCCCATGATGG + Intergenic
1168226325 19:54997807-54997829 GGAGTCCAGCAGCACAATGATGG + Intronic
925052492 2:828020-828042 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
926061208 2:9806280-9806302 GCAGCCCAGAAGCTAAATGCAGG - Intergenic
926455865 2:13068202-13068224 GCATCCCAGAATCAACACGAAGG - Intergenic
926568759 2:14507110-14507132 GCAGCCTAGAAGCTCCAAGTGGG - Intergenic
927826061 2:26311055-26311077 GTAGCCCAGGAGCACCATGAGGG + Exonic
928625733 2:33138128-33138150 CCAACACAGAAGCAGCATGAAGG - Intronic
930886456 2:56332271-56332293 TCAGCCCAAAAGGACTATGAAGG - Intronic
932010775 2:67975507-67975529 GCAGCCGGGAAATACCATGAAGG - Intergenic
932493454 2:72135249-72135271 GAAGCCCAGCAGCACCCGGATGG + Exonic
933647879 2:84827070-84827092 CCAGCCCAGAGGCTCTATGATGG - Intronic
933837196 2:86255623-86255645 GTGGACCAGAAGCTCCATGAGGG - Intronic
935349430 2:102141079-102141101 CCAGCCCAGAAGCACTATGATGG - Intronic
935582857 2:104773913-104773935 GCAATGAAGAAGCACCATGATGG + Intergenic
936762643 2:115805078-115805100 GCAGCCCAGAAGCTCCAACTGGG - Intronic
937082594 2:119151110-119151132 GCAGCCCAGAAGCTGCAGTATGG + Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
938910653 2:135882665-135882687 GCCTCTCAGAAGCACCTTGAAGG + Intergenic
940006929 2:149016638-149016660 GCAGCACATAAGCAACATGATGG - Intronic
943091189 2:183376751-183376773 GCAGCCCAGGAGAGCAATGATGG - Intergenic
943495158 2:188610841-188610863 GCAGCCAAGGAGCACTATGCTGG + Intergenic
945036853 2:205711283-205711305 CCAGACAATAAGCACCATGAAGG - Intronic
945477557 2:210303541-210303563 GCAGCCCAGCCGCTCCATCATGG - Intronic
946088015 2:217194197-217194219 CCAGCCCATAAGCACTAGGAGGG - Intergenic
946377950 2:219325272-219325294 GCAGCCCTGAAGCACCTGGGAGG - Intergenic
946792474 2:223315154-223315176 GGATCACAGAAGCACCAGGAGGG - Intergenic
1169278384 20:4248475-4248497 GAAGCCCAGAACCTCCATGGTGG + Exonic
1169389871 20:5181216-5181238 GCAGCTCAGAAGAAACAAGAGGG - Intronic
1169418774 20:5442104-5442126 GCAGCACAGATGCACGTTGACGG + Intergenic
1170826977 20:19805203-19805225 GATGCCCTGAAGCACAATGAGGG + Intergenic
1170827644 20:19810095-19810117 GGAGCCCAGAAGTGCCAAGAGGG + Intergenic
1171346584 20:24470139-24470161 GCTGCCCAGCAGGGCCATGAGGG + Intronic
1172034246 20:32000428-32000450 GCAGCCCAGAGGGTCCCTGAGGG + Exonic
1172768672 20:37364379-37364401 GCCACCCAGGAGCACCGTGATGG + Intronic
1172874916 20:38158374-38158396 TGAGACCAGAGGCACCATGAGGG + Intronic
1173390369 20:42626724-42626746 TCAGCCCTGATGCACCATGATGG - Intronic
1174567409 20:51475462-51475484 GGAGCCCAAAAACAACATGAGGG - Exonic
1174708168 20:52678095-52678117 GCCTCCCATCAGCACCATGAGGG + Intergenic
1182307969 22:29384293-29384315 GAAGCCCTGAAACACCCTGATGG + Intronic
1182994158 22:34797578-34797600 GGAGCAAAGAAGCACCATCATGG + Intergenic
1184553523 22:45218872-45218894 TGAGCCCTGAAGCACCATCAGGG + Intronic
949392723 3:3580325-3580347 GCAGTCCAGAAGCAACAGGGTGG - Intergenic
950650966 3:14406410-14406432 GGAGCCCAGGAGAACCCTGATGG + Intronic
952295233 3:32056271-32056293 GCAGCTCAGAAGAAACAAGAGGG + Intronic
953311643 3:41886307-41886329 CCAGCCCAGATGATCCATGAAGG + Intronic
953352638 3:42227518-42227540 GCACACCAGAATCACCTTGAGGG - Intergenic
953363297 3:42320037-42320059 AGAGCCAAGAAACACCATGAAGG - Intergenic
953441217 3:42919112-42919134 GCAGCTCAGAAGCAGCAAAAGGG - Intronic
954241494 3:49297300-49297322 GCAGCCATGAAGCAGCATGTGGG + Intronic
954358845 3:50106760-50106782 GCAGCTGAGAAGCATCCTGAAGG - Exonic
954560217 3:51550165-51550187 GCAGCACAGGAGCACCCTGAGGG - Intronic
954571946 3:51648285-51648307 GCAGCCCAGAAGCTCCAACTGGG + Intronic
954637152 3:52077198-52077220 GCAGCCCATAGGCATCAGGAGGG + Intronic
954868760 3:53751124-53751146 CCAGCCCAGAAGCTCCCCGATGG + Intronic
954958437 3:54542616-54542638 GCAGCACAGGAGAAACATGAAGG + Intronic
955503236 3:59605654-59605676 CCAGCCCAGTAGCAAAATGATGG - Intergenic
955750385 3:62180490-62180512 GAAGGTCAGAAGCACCACGAGGG + Intronic
956547593 3:70421982-70422004 GCAACCCACAAGTAACATGAAGG + Intergenic
963458283 3:145574476-145574498 GCAGCTCAGAAGAAACAAGAGGG - Intergenic
964032361 3:152152703-152152725 GCCGCCCAGGAGCCCCATGGAGG - Intergenic
967287876 3:187890678-187890700 GCAGCCCAGAAGCTCCAACTGGG + Intergenic
968427731 4:534582-534604 GCAGGCCAGACGCAGCTTGAAGG - Intronic
972631582 4:40846647-40846669 CCTGCCCAGCAGCGCCATGATGG + Intronic
972918000 4:43904265-43904287 ACAGCCAAGAAGCACCCTGTAGG - Intergenic
974142079 4:57900089-57900111 GCAGCCCAGAAGCTCCAACTGGG + Intergenic
976678712 4:87731606-87731628 GCAACCCAGAAGTACAATGAGGG + Intergenic
978328736 4:107587974-107587996 GCAGCTCAGAAGGAACAAGAGGG - Intergenic
979349442 4:119628007-119628029 ACAGCCCAAAGGCAACATGACGG - Intronic
979946858 4:126843369-126843391 GCAGCCCAGAAGCTGCAGGCTGG + Intergenic
980419876 4:132545976-132545998 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
981255797 4:142659562-142659584 GCAGCTCAGAAACAACATGAGGG + Intronic
986054857 5:4126837-4126859 GCAACCAAGAGGCACCAGGACGG - Intergenic
989819522 5:45778612-45778634 GCAGCCCAGAAGCAGCCTCATGG - Intergenic
990622846 5:57578970-57578992 GCAGACCAACAGCACCATGAAGG - Intergenic
992783835 5:80151806-80151828 CCAGCACAGAAGCTACATGACGG - Intronic
994298016 5:98113930-98113952 GCAGCCCAGAAGCTCCAACTGGG + Intergenic
1001419744 5:171577609-171577631 TCAGTCCAGGAGCACCCTGAGGG - Intergenic
1001519356 5:172379778-172379800 GAAGCCCAGAAGCAAAGTGAGGG + Intronic
1005445486 6:25918291-25918313 GCTTCCCAGAACCACCAGGAAGG + Intronic
1006547635 6:34792576-34792598 GCAGGCCAGAAGGGCCTTGAGGG - Intronic
1007809637 6:44476820-44476842 GCAGCCCAGGAGTCCCTTGAGGG + Intergenic
1008635388 6:53405725-53405747 GCAGCCCAGAAGCTCCAACTGGG - Intergenic
1009870295 6:69445068-69445090 GCAGCCCAGAAGCTCCAACTGGG - Intergenic
1012439809 6:99252695-99252717 GCAGGCTAGAAGCACCCTGTAGG - Intergenic
1012525274 6:100169926-100169948 CCTGCCCAGAAGAAGCATGAGGG + Intergenic
1012583638 6:100897617-100897639 GCAGCTCAGAAGGAACAAGAGGG + Intergenic
1012861516 6:104565767-104565789 AATTCCCAGAAGCACCATGATGG - Intergenic
1013757324 6:113477022-113477044 TCTGCCCACAAGGACCATGATGG + Intergenic
1015270338 6:131331794-131331816 GCTGCCCAGAAGAAACAAGAGGG + Intergenic
1017682687 6:156880036-156880058 GGAGCCCAGATGCCCCCTGATGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1019207394 6:170373937-170373959 GCATGCCAGCAGCACCATGTTGG - Intronic
1019525041 7:1477049-1477071 GCGGCCCTCCAGCACCATGACGG - Intronic
1019601541 7:1886114-1886136 TCAGCCCAGCAGCACTGTGAGGG + Intronic
1019607648 7:1918193-1918215 GGAGCCCAGAAGCCCCACGATGG + Intronic
1024527630 7:50362260-50362282 TCATCCCTGAAACACCATGAGGG + Intronic
1025037582 7:55606958-55606980 ACAGCCAACAAGCACAATGAAGG + Intergenic
1025189868 7:56888247-56888269 ACAGCCCAGGAGCACCATGATGG - Intergenic
1025682071 7:63688674-63688696 ACAGCCCAGGAGCACCATGATGG + Intergenic
1026159876 7:67859432-67859454 GCAGCCAAGAATCACCACGAGGG - Intergenic
1029236606 7:99125127-99125149 GGAGTTCAGAAGCACCATCATGG + Intronic
1030074763 7:105726766-105726788 GCAGCACAGGAGGACCAAGATGG - Intronic
1030682887 7:112451198-112451220 GCATCCCAGGAGCTCCATGTTGG - Intronic
1030833517 7:114255438-114255460 GCAGCCCAGAAGCTCCAACTGGG - Intronic
1031030280 7:116726923-116726945 GCTGCCCAGAAGCACCACTGTGG + Intronic
1033784107 7:144709478-144709500 GTAGCCTAGAAGCAACAGGACGG + Intronic
1033865996 7:145691300-145691322 GCAGCTCAGAAGGAACAAGAGGG + Intergenic
1033935239 7:146575953-146575975 GCAGCCTTGAATCACCATTAAGG - Intronic
1033940985 7:146653409-146653431 CTAGCCGAGAAGCTCCATGAAGG - Intronic
1035844049 8:2844050-2844072 GCAGCCCAGAAGCAGACTGGTGG + Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037715219 8:21391771-21391793 GCTGCTCAGAAACACCAGGAAGG + Intergenic
1038441173 8:27571776-27571798 CCAGGCCAGAAGGACCCTGAAGG - Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1042962281 8:74316420-74316442 ACAGACTAGAAGCACCCTGAGGG + Intronic
1043418985 8:80079729-80079751 GAAGGCCAGGAGCACCATCAGGG - Intronic
1046091602 8:109509499-109509521 GCAGCACAGAAAAATCATGAAGG + Intronic
1046285546 8:112088567-112088589 TCTTCCCAGAGGCACCATGAAGG - Intergenic
1048175955 8:132153136-132153158 GCAGCTCAGAAGAAACAAGAGGG + Intronic
1048430563 8:134366780-134366802 ACAGACACGAAGCACCATGAAGG + Intergenic
1049278562 8:141732259-141732281 GGAGCCCAGAAGGACAATGGGGG - Intergenic
1049445326 8:142627835-142627857 CCAGCCCGGGAGCACCTTGAGGG + Intergenic
1050536414 9:6634571-6634593 GCAGCCCAGGAGAAGCATGGCGG - Intronic
1052068493 9:24052609-24052631 GCAACCCTGAAGCACCAAGATGG + Intergenic
1052755839 9:32539941-32539963 ACAGTCCATAAGCACCATCAAGG + Intergenic
1052955895 9:34253071-34253093 GCAGCCGGGAAGCACCAATAAGG + Exonic
1053484677 9:38442789-38442811 GCAGCCCTGAAGCTCCATTTGGG - Intergenic
1057397520 9:94693009-94693031 GCAGCCCAGGAACACCAGCATGG - Intergenic
1057917857 9:99071528-99071550 GCAGCCCAGAATCTCCATGTAGG + Intergenic
1060135909 9:121153584-121153606 GGAGCCCAGGAGCTCCTTGAAGG + Intronic
1061224484 9:129272802-129272824 GCGGACCACAAGCTCCATGAGGG + Intergenic
1061543518 9:131290722-131290744 GCTGCCCAGAGGCAGCTTGAAGG + Intronic
1061575083 9:131501343-131501365 GCAGCCAAGAACCATAATGAAGG + Intergenic
1187129593 X:16489539-16489561 ACAGGCCAGAAGTACCAGGATGG + Intergenic
1188803706 X:34561173-34561195 GCAGCTCAGAAGGAACAAGAGGG - Intergenic
1191822927 X:65332617-65332639 GCATCCCAGAAGAAACAAGAGGG - Intergenic
1192849164 X:74935871-74935893 TCAGGACAGAAGCTCCATGAGGG + Intergenic
1193356151 X:80522258-80522280 GCAGCCAAGAAGCACCCTTCTGG + Intergenic
1196372978 X:114999554-114999576 GCAGCTCAGAAGAAACAAGAGGG + Intergenic
1196936430 X:120735303-120735325 GGAGCCCAGATGCACCAGAATGG + Intergenic
1200843493 Y:7807890-7807912 GCAGAACAGTAGCATCATGAAGG + Intergenic