ID: 1104648209

View in Genome Browser
Species Human (GRCh38)
Location 12:130511966-130511988
Sequence CAAGCTCAGGCTTCTGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104648202_1104648209 -5 Left 1104648202 12:130511948-130511970 CCTTCGTATGAAACCCACCAAGC 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1104648199_1104648209 23 Left 1104648199 12:130511920-130511942 CCTCTGGGCTTCCTGAGCACAAC 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1104648198_1104648209 26 Left 1104648198 12:130511917-130511939 CCACCTCTGGGCTTCCTGAGCAC 0: 1
1: 0
2: 7
3: 54
4: 473
Right 1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1104648201_1104648209 -4 Left 1104648201 12:130511947-130511969 CCCTTCGTATGAAACCCACCAAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1104648200_1104648209 12 Left 1104648200 12:130511931-130511953 CCTGAGCACAACAGTGCCCTTCG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104648209 Original CRISPR CAAGCTCAGGCTTCTGTGAG GGG Intronic
900798035 1:4721185-4721207 GAAGCCCAGGCATTTGTGAGTGG + Intronic
901495929 1:9621856-9621878 CAAGGTCAGGATTGTGAGAGGGG + Intergenic
902389961 1:16097710-16097732 CAAGCCCAGCCTTCTGTCTGAGG + Intergenic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
902727845 1:18349222-18349244 CAAGCTCTGGCTTCAGAGAGAGG - Intronic
903073228 1:20739497-20739519 GAAGCTGTGGCTCCTGTGAGGGG + Intergenic
904253579 1:29240713-29240735 CAGTCTCAGGCTTTTGTGATGGG + Intronic
904897230 1:33826049-33826071 AAATCTCAGACATCTGTGAGAGG - Intronic
905212382 1:36383524-36383546 CAAACCTAGGCTTCTGAGAGAGG - Intronic
905492111 1:38352772-38352794 CAGGCTTGGGCTTCTGTGTGAGG + Intergenic
905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG + Exonic
906819921 1:48918656-48918678 CATGGTCAGGTTTCGGTGAGAGG - Intronic
909038987 1:70628121-70628143 CAAGCACAAGCTCATGTGAGTGG - Intergenic
914997689 1:152559249-152559271 CAAGCCCAGGCTTCCATCAGGGG - Intronic
915247481 1:154567122-154567144 CTTGATCAGGCCTCTGTGAGTGG + Intergenic
916057269 1:161076451-161076473 CTTGCTGAGGCCTCTGTGAGGGG - Exonic
917566171 1:176214137-176214159 GATGCTCAGGCGTCTGTGTGAGG - Intergenic
921210471 1:212892317-212892339 CAAGCTCATTCTCTTGTGAGGGG + Intronic
921667444 1:217889661-217889683 CCAACTCTGGCATCTGTGAGTGG + Intergenic
922808391 1:228402199-228402221 AAAGGGCAGGCTTCTGTGACAGG - Intronic
1065858415 10:29849539-29849561 CTAGCTCAGGCTTCTCTCTGTGG + Intergenic
1068061933 10:52079351-52079373 AAAGCTCAGGCTTCGGGCAGGGG - Intronic
1070694537 10:78552195-78552217 GAAGCTCAGGCTGCTGTGTTTGG - Intergenic
1071559556 10:86634349-86634371 CAAGCTGAGGCTTTTGGGAAAGG + Intergenic
1074323918 10:112429678-112429700 AAAGCTGAAGCTTGTGTGAGTGG - Intergenic
1074771186 10:116735480-116735502 CAAGCTCAGGCTTCTTTATGTGG - Intronic
1076272473 10:129166297-129166319 CAACCTCATGGTTCTCTGAGGGG + Intergenic
1076420334 10:130327080-130327102 AAAGCACAGGCTTCTGGGAGAGG - Intergenic
1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG + Intronic
1077511485 11:2966707-2966729 CCAGCGCATGCTTCTGTGGGTGG - Intronic
1077533027 11:3106113-3106135 AGAGCTCAGGCTCCTGTGCGGGG - Intronic
1081988711 11:47326035-47326057 AAAGCACAGGCTTCGGTGTGAGG + Intronic
1082794108 11:57367828-57367850 CAAGATGATGCTTGTGTGAGGGG + Intronic
1083811101 11:65107481-65107503 CAAGCTGGGGCGTCTGTGAAGGG + Intronic
1084859199 11:72007170-72007192 CAAGGTCAGGCTGCTGGGACAGG - Exonic
1086774699 11:90815759-90815781 AAAGTTCAGGTTTCTGTGAATGG - Intergenic
1088226034 11:107621284-107621306 CAAGCTCAAACCTCTGTGGGAGG + Intronic
1089605450 11:119638772-119638794 AAGGCTCCGGCTTCTGGGAGAGG + Intronic
1090407821 11:126487950-126487972 CCACCTCCGCCTTCTGTGAGCGG - Intronic
1090520735 11:127476266-127476288 AAATCTCAAGCTTCTGTGATTGG + Intergenic
1090619852 11:128550656-128550678 CAACCTCGGCCTTCTGTGAAAGG + Intronic
1090835995 11:130454293-130454315 CAAGCTCAGGGTTGTGAGAGGGG - Intronic
1091372544 11:135072994-135073016 CAAGCACATGCTTCTCTGTGTGG - Intergenic
1094013695 12:25838215-25838237 CATGCACAGCCTTCTGTGTGAGG - Intergenic
1095777209 12:46023532-46023554 CAGGTTCAGGCTTCCATGAGAGG - Intergenic
1095921136 12:47532538-47532560 CAATCTCAGGCATCTGTGGGAGG + Intergenic
1098378460 12:69842905-69842927 CAAGCTCACGGTCCAGTGAGAGG - Intronic
1101581520 12:106046425-106046447 CAAGCTCAGGCTCCACAGAGAGG - Intergenic
1103817599 12:123671294-123671316 CATCCTGAGGCTTCTGTGGGGGG + Exonic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1106230479 13:27817396-27817418 CAACCCCTTGCTTCTGTGAGAGG - Intergenic
1106796968 13:33216845-33216867 CAAGCTAAGGAATCTGAGAGTGG + Intronic
1106976574 13:35224890-35224912 TATGCTAAGGCTTTTGTGAGAGG + Intronic
1107709786 13:43140479-43140501 CAAGCACAGGCCTCTGGAAGTGG - Intergenic
1107715122 13:43192336-43192358 CAAGCTCGGGAATCTGGGAGCGG + Intergenic
1107967814 13:45613349-45613371 CAAGCTCCAGCTTTTGTCAGGGG + Intronic
1109328477 13:60899446-60899468 CAAGCCAAAGCTTCTGTTAGAGG + Intergenic
1113560238 13:111272899-111272921 CACGGGCAGGCTTCTGTGGGGGG - Intronic
1113812281 13:113150017-113150039 CCAGCTCAGGCTTGTGTGGTGGG + Intergenic
1114622866 14:24108173-24108195 GAAGCTCTGGCTTCTTTCAGGGG + Intronic
1114697979 14:24645071-24645093 CAGGCTCAGGCTTGTATGAGAGG + Intergenic
1120116911 14:80629248-80629270 CAAACTCAGTCTTCTGAGACTGG + Intronic
1121461528 14:94082542-94082564 CAAGCTCACTCTTTTGTTAGAGG + Intronic
1121841994 14:97142333-97142355 CAACCTCAGGGTCCTGGGAGAGG - Intergenic
1122338452 14:101008840-101008862 CAAGCCCAGGCAGCTGAGAGTGG - Intergenic
1122810349 14:104284611-104284633 AGAGCTCAGGCCTGTGTGAGGGG + Intergenic
1130117155 15:81015092-81015114 CAGGATCAGGCTCCTGTGAATGG + Intronic
1130195601 15:81777816-81777838 GAAGCTCAGACTTCTGTGAAGGG - Intergenic
1131102438 15:89703500-89703522 CAAGCTCTGGTTTGTATGAGAGG - Intronic
1132339830 15:101071182-101071204 AGAGCTCATGCTTCAGTGAGGGG + Intronic
1132884575 16:2177002-2177024 CAGGCACTGGCTGCTGTGAGTGG + Exonic
1134300181 16:12983867-12983889 TTAGCTCAGGCTACTTTGAGGGG + Intronic
1135462333 16:22655668-22655690 GAAGCTGAGGCTGCGGTGAGTGG - Intergenic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1135962902 16:27012552-27012574 AAACTTCAGGCTTATGTGAGAGG - Intergenic
1136101954 16:28003258-28003280 CATTCTCAAGCTCCTGTGAGTGG - Intronic
1138006084 16:53339108-53339130 CAAGTTCAGGCTTGTGTGCCTGG - Intergenic
1138183518 16:54959447-54959469 CAAGCTCAGGGGTTTGTGGGTGG - Intergenic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1141238709 16:82244499-82244521 CAAGAAGAGGGTTCTGTGAGGGG + Intergenic
1142159640 16:88550418-88550440 CAAGGGCAGCCTTCTGTGTGGGG - Intergenic
1143685506 17:8511738-8511760 CAAGGTGATGCTTCTGTGTGGGG - Intronic
1144961418 17:19046187-19046209 CATGCCCAGGATTCTGGGAGTGG - Intronic
1144973742 17:19128337-19128359 CATGCCCAGGATTCTGGGAGTGG + Intronic
1145769772 17:27484753-27484775 CAAGCTTCGGCTCCTCTGAGAGG - Intronic
1146502172 17:33373518-33373540 CAAGATTAGGATTCTGAGAGAGG + Intronic
1147402508 17:40189423-40189445 CAAGCTCAGGGCTCTGGGGGAGG + Intronic
1149303597 17:55327840-55327862 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
1150316883 17:64176226-64176248 CAAGCTCTGGCTGCTGTCTGTGG - Intronic
1152360678 17:79831864-79831886 CTAGCCCTGGCTTTTGTGAGTGG - Intergenic
1152889359 17:82871693-82871715 CAGGCTCAGGCTACTGTGCTGGG + Intronic
1153493826 18:5677210-5677232 AGAGCTGAGGCATCTGTGAGTGG + Intergenic
1153651843 18:7247997-7248019 CCAGCACAGGCTTCCATGAGTGG + Intergenic
1153978594 18:10290646-10290668 GAAGCTCAGGCCTCTGTCTGGGG + Intergenic
1156140761 18:34107802-34107824 CAAGTTCATGTTTCTGTGAGGGG - Intronic
1157223919 18:45846073-45846095 CAGCCTGAGGCTTCTGTGACTGG - Intergenic
1157677949 18:49581187-49581209 GAAGTTGAGGCTGCTGTGAGCGG + Intronic
1157816377 18:50732156-50732178 GGATCTCAGGCATCTGTGAGGGG - Intergenic
1159959972 18:74547700-74547722 GAAGCTCAGGCAGCTGTGGGAGG + Intronic
1160039910 18:75336236-75336258 CTAGCTCAGTCATCTGTGCGCGG - Intergenic
1160190508 18:76710919-76710941 CAAGAGCAGGCATCTGTCAGTGG - Intergenic
1160340536 18:78085381-78085403 CAAGCTCAGGGACCTGTTAGAGG - Intergenic
1160419231 18:78732712-78732734 CCAGCCCAGTCTTCCGTGAGTGG + Intergenic
1161037422 19:2093077-2093099 CAAGCTCAGTCAGCTGTGTGGGG + Intronic
1161283861 19:3459066-3459088 CAAGCTCAGGGCCCTTTGAGCGG - Intronic
1162035550 19:7936624-7936646 CAAGCCCTGGCTTCTGGGAATGG - Intronic
1162722517 19:12670729-12670751 CTGGCTCAGGCCTCCGTGAGCGG - Exonic
1162897908 19:13776412-13776434 CACCCTCTGGCTTCTGTGAGAGG - Intronic
1164135533 19:22412219-22412241 CAAGCTGTGGCCTCTGTGTGTGG - Intronic
1164162901 19:22641444-22641466 CAAGCTGTGGCCTCTGTGTGTGG + Intronic
1165528468 19:36376871-36376893 CAAGCTCAGGCAGCTTTAAGTGG + Intronic
1167142826 19:47664040-47664062 CAGAGTCAGGCTTCTGCGAGCGG + Intronic
1167431071 19:49454646-49454668 GGAGCTTAGGCTTCTTTGAGGGG + Intronic
1168024564 19:53634463-53634485 AAAGCTCAGGCTTTTGAGAATGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
924997576 2:377062-377084 CAAACTGATGTTTCTGTGAGGGG - Intergenic
925093461 2:1173802-1173824 GGAGCCCAGGCTTCTGAGAGAGG - Intronic
929040373 2:37738693-37738715 CAAGCTCTGGCCTATCTGAGTGG + Intergenic
929757682 2:44780907-44780929 CACTCTCAGGCTACTGAGAGAGG + Intergenic
930716188 2:54596124-54596146 CAAGCTCAAGCTGCTGTGACTGG - Intronic
931403354 2:61952275-61952297 CAAGATTAGGATTATGTGAGGGG + Intronic
931966581 2:67542748-67542770 CAGGGTCAGGCTTGTGTGAGAGG - Intergenic
932081705 2:68721777-68721799 CGACCTTAGGTTTCTGTGAGAGG - Intronic
935756719 2:106282168-106282190 GAAGCTCAGCCTGCTGAGAGCGG - Intergenic
936112843 2:109678857-109678879 GAAGCTCAGCCTGCTGAGAGCGG + Intergenic
937591134 2:123614623-123614645 CAAGCTCTGAATTCTGGGAGGGG - Intergenic
937672842 2:124557231-124557253 GAAACTCAGGTTTCTCTGAGTGG - Intronic
939881381 2:147635403-147635425 CAAGCTAAGGAATCTGAGAGTGG + Intergenic
946414069 2:219530646-219530668 CATGCTGAGGCTTCAGTGATGGG + Intronic
947844617 2:233233884-233233906 CAAGCTGAGACTTCTGTGGGAGG - Intronic
947859467 2:233348474-233348496 CACCCTCTGCCTTCTGTGAGTGG - Intergenic
1169314339 20:4576054-4576076 AAAGCTCAGGATGCTGGGAGTGG + Intergenic
1170519485 20:17169121-17169143 CAAGCTGAAACTTATGTGAGGGG - Intergenic
1171398137 20:24852882-24852904 CAAGCTTAGGATTTTGAGAGGGG - Intergenic
1171484442 20:25477014-25477036 CAAGGTCAGGTCTCTGCGAGCGG + Exonic
1171572785 20:26269534-26269556 CAAGCTCAGGATTCAGGGCGGGG + Intergenic
1172090782 20:32430815-32430837 TTTGCTGAGGCTTCTGTGAGAGG + Intronic
1172450154 20:35016378-35016400 CAAACTCATGCTTCTGTGATAGG - Intronic
1173502670 20:43565463-43565485 CCAGCCCAGGCTTCCCTGAGAGG - Intronic
1174376316 20:50128889-50128911 CCAGCCCCTGCTTCTGTGAGTGG - Intronic
1175618071 20:60420444-60420466 CAGGTTCAGGCTTCTATGAGAGG - Intergenic
1178393054 21:32214994-32215016 CAAACTCAGGACTCTGTGAGAGG + Intergenic
1182279054 22:29207690-29207712 GATGCTCAGGCTACTGTGATAGG - Intronic
1183745581 22:39689781-39689803 CAAGCTGAGGCTTCTCTCAAGGG + Intergenic
949738923 3:7207351-7207373 CAAGCTCAGTCATTTTTGAGAGG - Intronic
951708942 3:25570412-25570434 CAAGGTTTGCCTTCTGTGAGAGG + Intronic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953420139 3:42747894-42747916 CAAGCTGACGATTCTGGGAGAGG - Intronic
954139395 3:48597040-48597062 AAAGGACAGGCTGCTGTGAGAGG + Intergenic
954682947 3:52355697-52355719 CCAGCTCAGGCATCTCTGGGTGG - Intronic
957950663 3:87122037-87122059 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
959006438 3:101025842-101025864 CAAGTTCAGGCTTGCATGAGAGG - Intergenic
962385865 3:134932159-134932181 CCAGAGCAGGCTTCTGTGAAGGG + Intronic
962480148 3:135790979-135791001 TAATCTCAGCCTTGTGTGAGGGG - Intergenic
964011629 3:151898867-151898889 CAAGGTTAGGATTCTGAGAGAGG + Intergenic
968132953 3:196202685-196202707 CAAGCTCAAGCTGCTGTGTGCGG + Intronic
968620151 4:1600303-1600325 CACCCTGAGGCTCCTGTGAGGGG - Intergenic
968654443 4:1772511-1772533 GAAACTCAGGCTACTGTCAGGGG + Intergenic
969375199 4:6758898-6758920 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
969657803 4:8508225-8508247 ACAGCTCAGGTTTCTGTGTGGGG + Intergenic
970222069 4:13821623-13821645 CCAGCCAAGGCTTCTGTCAGTGG - Intergenic
972273882 4:37539065-37539087 CAAGCTAAGGAATCTGGGAGTGG + Intronic
972868828 4:43270009-43270031 CAAGCTCAGGGTTCCATAAGCGG - Intergenic
973972823 4:56230641-56230663 TAAGCTCAGCCCTCTGTGACAGG - Intronic
975557248 4:75676762-75676784 AAAGATCTGGCTGCTGTGAGGGG - Intronic
975614618 4:76234233-76234255 CATCCTCAGACTTCTGAGAGTGG - Intronic
980754375 4:137138195-137138217 CTAGCTTAGGGTTCTGTAAGAGG - Intergenic
983789246 4:171775176-171775198 ATAGCTGAAGCTTCTGTGAGCGG - Intergenic
984833822 4:184000516-184000538 CAAGCTCTGCATTCTATGAGGGG - Intronic
984854953 4:184187110-184187132 TAAGGTCTGGCATCTGTGAGAGG + Intronic
984926720 4:184813800-184813822 CCAGCTCTGGCTACTGTGAAAGG - Exonic
984992202 4:185391860-185391882 CTAGCTCTGCCTGCTGTGAGAGG - Intronic
985294943 4:188426980-188427002 CAAGCAGAGGCTGCAGTGAGCGG - Intergenic
985614307 5:910386-910408 ATAGCTCAGGGTTCTGTGGGGGG + Intronic
988500720 5:31781439-31781461 AAAACCCAGGCTTCTGTTAGGGG + Intronic
990411845 5:55548899-55548921 CAAGCTCAGTCTTCTGAGTTAGG + Intergenic
990593891 5:57294092-57294114 CCATCTCAGGCCTCTGTGATTGG - Intergenic
991957908 5:72014214-72014236 CAGGCACACACTTCTGTGAGAGG + Intergenic
992002061 5:72445345-72445367 CCAGACCAGGCTTCTGGGAGGGG + Intronic
993968607 5:94389081-94389103 CAAGCTAAGGAATCTGGGAGTGG + Intronic
994903367 5:105804234-105804256 CAAGATCAGGATTATGAGAGGGG - Intergenic
995479390 5:112579961-112579983 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
996389230 5:122941936-122941958 CAGGCACAGGCTCCTGTGACAGG + Intronic
997247768 5:132365406-132365428 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
999131773 5:149289068-149289090 CATGCACAGGTTTGTGTGAGGGG - Intronic
999836754 5:155382053-155382075 CCAGCCCAGGCTGCAGTGAGTGG - Intergenic
1000028550 5:157381596-157381618 TCAGATCAGGCTCCTGTGAGGGG + Intronic
1001663037 5:173410911-173410933 CCAGCTCAGGGTTCAGTGAACGG + Intergenic
1003066143 6:2904579-2904601 CAACCCCTGGCTTCTGGGAGAGG + Intergenic
1003787931 6:9507724-9507746 CAAGGTCATGCTGCTGTTAGAGG - Intergenic
1004320110 6:14625548-14625570 CAAGCTTACTCTTCTTTGAGGGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1007013866 6:38443188-38443210 AAAATTCAGGCTGCTGTGAGGGG + Intronic
1007023698 6:38547753-38547775 GAAGTTCAGGATTCTCTGAGAGG - Intronic
1007420519 6:41716484-41716506 CCAGCTCTAGCTCCTGTGAGTGG - Intronic
1007424192 6:41736136-41736158 CAAGCTCAGGCTGGTGAGTGGGG - Exonic
1008065456 6:47042816-47042838 CAACCTCAGACTTCTGGGTGGGG + Intergenic
1011057210 6:83218247-83218269 CTAGCTCAGCCTTCTGGAAGGGG - Intronic
1011629887 6:89312998-89313020 CAAGCCCAGGCTGCTGAGTGGGG + Intronic
1012829663 6:104188257-104188279 CAGGTTCAGGCTTGTATGAGAGG + Intergenic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1014752081 6:125268035-125268057 CAAGCACAAGCTCATGTGAGTGG - Intronic
1014753079 6:125274249-125274271 CAAGCACAGGCTCATGTGAATGG - Intronic
1015012323 6:128365222-128365244 CAAATTCAGGCTTTTGTTAGGGG + Intronic
1016878384 6:148886095-148886117 CCATCTCAGGCTTCTGTGTGAGG - Intronic
1018164038 6:161077003-161077025 GGAGGTCAGGCTTCTCTGAGGGG + Intronic
1018251601 6:161877286-161877308 CAGCCTCAGGCTCCTGTGAAGGG + Intronic
1019171530 6:170135941-170135963 CGAGCTCTGGCCTCTGCGAGTGG - Intergenic
1019361276 7:605331-605353 CAAGGTCAGGCTGCCGTGCGGGG + Intronic
1020276617 7:6628493-6628515 CAAGCTGAGGCTAAAGTGAGGGG - Intergenic
1021382507 7:19984480-19984502 CAAGTTCAGACTGCTGGGAGAGG + Intergenic
1022117211 7:27272416-27272438 CAGGCACAGGGTTGTGTGAGGGG + Intergenic
1022130652 7:27401628-27401650 AAAGCTCACTCTTCTGGGAGGGG - Intergenic
1022574743 7:31486648-31486670 CAAACTCAGGCTGCTTTGGGTGG + Intergenic
1022812870 7:33886440-33886462 CTATCTCAGTCTTTTGTGAGGGG - Intergenic
1023131382 7:37006454-37006476 CAAGGTCACACTGCTGTGAGGGG + Intronic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023222124 7:37930117-37930139 CAAAAGCAGCCTTCTGTGAGCGG - Intronic
1024035454 7:45504232-45504254 CAAGATCAGGATTATGGGAGGGG + Intergenic
1024150588 7:46568010-46568032 CAAGGTCAGGCTTCAGTCTGTGG + Intergenic
1024519978 7:50297095-50297117 CTCTCTCTGGCTTCTGTGAGGGG + Intergenic
1025191891 7:56901926-56901948 CAAGCTCATGCCCCTGTGACCGG + Intergenic
1026165650 7:67906872-67906894 GAAGCACAGACTTCTTTGAGAGG + Intergenic
1029165897 7:98590267-98590289 CAAGCTCAGAATTGTGTGAATGG - Intergenic
1029628433 7:101734936-101734958 CCAGCTCAGGGATCTCTGAGAGG + Intergenic
1032257995 7:130312062-130312084 AAAGCTCTGGCTTCTGTGTCGGG + Exonic
1032387753 7:131536393-131536415 GATGCTGAGGCTTCTGTGGGAGG + Intronic
1032570959 7:132996379-132996401 GAAGCTCAGGACTCTGTGAATGG - Intronic
1035789354 8:2289606-2289628 CAAGATCAGGATTATGGGAGGGG + Intergenic
1035803451 8:2432099-2432121 CAAGATCAGGATTATGGGAGGGG - Intergenic
1036912116 8:12766146-12766168 TAGGCTCAGGCTGCTGTGAATGG + Intergenic
1038228569 8:25679733-25679755 CCAGCCAAGGCTCCTGTGAGAGG - Intergenic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1047863296 8:128992718-128992740 CAAGATAAGTCTTCTGTGACAGG + Intergenic
1048061543 8:130924301-130924323 CAAGCTAAGGAATCTGAGAGTGG + Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049492794 8:142914053-142914075 CAAACTCAGTCTCATGTGAGGGG + Intronic
1050425822 9:5511679-5511701 CAAGCCTAAGATTCTGTGAGTGG + Intronic
1050555813 9:6788879-6788901 CAGGCAGAGGCTGCTGTGAGGGG + Intronic
1051360685 9:16278933-16278955 CACGCACACGCATCTGTGAGTGG + Intergenic
1053449575 9:38181721-38181743 CCAGCTCTGGCTACTGTGACAGG - Intergenic
1055339345 9:75264402-75264424 CAAGCTCAGACTTCTGGGATTGG + Intergenic
1057955220 9:99401870-99401892 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
1058729675 9:107837810-107837832 CAAGTTGAGGCTTTGGTGAGAGG + Intergenic
1058977583 9:110138714-110138736 CAAGCTCAGGGTTCTTCTAGAGG - Intronic
1059391939 9:114004714-114004736 CATGGCCAGGCTTCTGTAAGTGG - Intronic
1059537399 9:115094250-115094272 CAAGCTCAGGCTTAAGTAAAAGG - Intronic
1059978020 9:119738588-119738610 GAAGCTCAGCTTTCAGTGAGAGG - Intergenic
1061615895 9:131778657-131778679 AAAGCTCAGACTTCACTGAGAGG - Intergenic
1062313804 9:135955276-135955298 CAAGGTAAGGCTGCTGTGGGCGG - Exonic
1062449824 9:136610797-136610819 CCAGCTCAGGCTACAGGGAGAGG - Intergenic
1062631040 9:137463311-137463333 CCAGCCCAGGCTTCTTGGAGCGG + Intronic
1187390243 X:18882048-18882070 CAACCTCCGGCTTCTTTGTGGGG + Intergenic
1190776975 X:53560506-53560528 AAAGCTCAGGTTTCCGTGTGAGG - Intronic
1191116950 X:56862724-56862746 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
1195146384 X:102021509-102021531 AGACCTCAGTCTTCTGTGAGGGG - Intergenic
1196599351 X:117584389-117584411 CAGGTTCAGGCTTGCGTGAGAGG - Intergenic
1197431894 X:126376878-126376900 CAAGCTGTGGCTTCAGAGAGTGG - Intergenic
1197663131 X:129195060-129195082 CAAGGTTAGGCTTATGAGAGAGG - Intergenic
1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG + Intergenic