ID: 1104650010

View in Genome Browser
Species Human (GRCh38)
Location 12:130524676-130524698
Sequence GGTGTTAAGGGGATTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104650010 Original CRISPR GGTGTTAAGGGGATTGAAGA AGG Intronic
900686824 1:3954035-3954057 GGTTTTCAGGGGGTTGAAAATGG + Intergenic
901324517 1:8358695-8358717 GGGGTTAAGGGGCATGTAGAAGG + Exonic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
901963542 1:12847215-12847237 GGTGTCAAGGGAAGTGAAAATGG + Intergenic
903685098 1:25125413-25125435 GGTGTTGGCGGGAGTGAAGAAGG + Intergenic
903730190 1:25487971-25487993 GTTGTTATAAGGATTGAAGAAGG + Intronic
906237115 1:44218812-44218834 GGAGTTGAGGGGATGGAGGATGG - Intronic
906406703 1:45548075-45548097 GGTGTTTAGGAGACTGAAGTGGG - Intergenic
908896994 1:68911840-68911862 GGTTTTAAGGGGATTTATGGAGG - Intergenic
910259150 1:85279150-85279172 TGTGCTAAGGGGAAAGAAGATGG + Intergenic
911713224 1:101098711-101098733 GGTGATAAGGTGTTGGAAGAGGG + Intergenic
912437932 1:109674985-109675007 GGGTTTAGGGGGAGTGAAGAGGG - Exonic
912440443 1:109693444-109693466 GGGTTTAGGGGGAGTGAAGAGGG - Exonic
913283009 1:117203263-117203285 GGTTGTAAGAGGATTGAAGAGGG + Intronic
913315807 1:117550292-117550314 GCAGCTAAGGGGATAGAAGATGG - Intergenic
913329914 1:117658780-117658802 GATGTGAAGAGGATTGAAGCTGG + Intergenic
913330255 1:117661386-117661408 GGTACTAAGAGGATTGGAGAAGG - Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914440363 1:147700285-147700307 GGTGTTGAGGAGATTGAGGTGGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915057792 1:153151462-153151484 GGTATTAATGGGCTTGAACAAGG + Intergenic
915253344 1:154606607-154606629 GGTGTTTAGGGGATTTAAGGGGG - Intronic
915772715 1:158445619-158445641 GTAGTTAAGGGGGTTGCAGATGG + Intergenic
916868732 1:168888644-168888666 TGTGTAAAGGGTATTGGAGAAGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
920138878 1:203793014-203793036 GGTAATAAGGACATTGAAGAGGG - Intergenic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
922604343 1:226880022-226880044 CTTGTTAAGGGGATTGAAATTGG + Intronic
922701118 1:227761691-227761713 GGTGGTGTGGGGACTGAAGAGGG + Intronic
923818502 1:237406994-237407016 GGAGTTCAGGGGAGGGAAGAAGG - Intronic
924111389 1:240703148-240703170 GGGGTTCAGGAGAATGAAGATGG + Intergenic
1062881684 10:983700-983722 AGTGTTAAGGTGTTTGGAGATGG - Intergenic
1065734984 10:28743474-28743496 GGTTTTAAGGGGGGTGGAGAGGG + Intergenic
1067513309 10:46913142-46913164 GGTGTTGTGAGGATTAAAGAAGG + Intronic
1067648943 10:48138700-48138722 GGTGTTGTGAGGATTAAAGAAGG - Intergenic
1073165447 10:101445108-101445130 GTTATTAATGGCATTGAAGATGG + Intronic
1075081588 10:119387583-119387605 GCTGGTCAGGGGATTGAAGAGGG + Intronic
1075830932 10:125410209-125410231 TATTTGAAGGGGATTGAAGAGGG - Intergenic
1078773617 11:14374072-14374094 GGTGATAAGAGCATTGAATAAGG + Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080536846 11:33230267-33230289 GGTGGGAAGGGGATGGATGATGG + Intergenic
1081439787 11:43067417-43067439 GGTGTCAAGGAGAGTGAAGAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089272455 11:117311453-117311475 GGTGTGAAGGGAAAGGAAGAGGG - Intronic
1090097213 11:123754129-123754151 GTGGTGAAGGGGATTGCAGATGG + Exonic
1094284503 12:28777727-28777749 GGTGAATAGGGGATTGGAGAGGG - Intergenic
1095679746 12:44960420-44960442 AGTGAGAAGGGGATTGCAGAAGG - Intergenic
1095742866 12:45625848-45625870 GGTGGGAAGGGGACTGAAGTGGG + Intergenic
1096387557 12:51204807-51204829 GGTTTCAAGGGAAGTGAAGAGGG - Intronic
1096399854 12:51296876-51296898 GTTGTTAAGGGAGATGAAGAGGG + Intronic
1096726140 12:53564450-53564472 AGTGGTTTGGGGATTGAAGAAGG - Intronic
1097438410 12:59578952-59578974 GGTGCTCAGGGGACTGAAGCTGG + Intergenic
1100359267 12:93861298-93861320 TGTGATAAGAGGATTGAAGCAGG + Intronic
1101302033 12:103492982-103493004 AGTGTTAATGGAAATGAAGATGG - Intronic
1101385145 12:104250700-104250722 GATGATAAGGAGATTGAAGAAGG + Intronic
1101697102 12:107137115-107137137 GATGATAAGGGAATAGAAGAGGG + Intergenic
1101828249 12:108237461-108237483 GGTGTTAAGGACAGTGGAGAGGG + Intronic
1102653511 12:114460861-114460883 GTTGTTATGGGGATTGAACAAGG + Intergenic
1104650010 12:130524676-130524698 GGTGTTAAGGGGATTGAAGAAGG + Intronic
1105768347 13:23582722-23582744 GGTTGTCAGGGGCTTGAAGAGGG - Intronic
1105932150 13:25062690-25062712 GGTGAGAAGGGCATTGAAGATGG + Intergenic
1108211750 13:48146345-48146367 GTTGCCAAGGGGAGTGAAGAGGG - Intergenic
1110430847 13:75421322-75421344 GGAGTTAGGGGGATTGTAAATGG - Intronic
1111374594 13:87362572-87362594 GGTGTTAAAGGGATTAAACATGG - Intergenic
1111862663 13:93727997-93728019 GGTGTTGATGGGAGTGAAGAGGG - Intronic
1113966043 13:114154784-114154806 GGTGTGTAGGGGATTGCAGTTGG + Intergenic
1114204420 14:20555276-20555298 GATGTTAAGAAGTTTGAAGAAGG + Intergenic
1115251077 14:31348673-31348695 GTTGTTGAGAGGATTAAAGAAGG - Intronic
1116313285 14:43353970-43353992 GGCCTTAAAGGGATAGAAGATGG - Intergenic
1118281442 14:64432686-64432708 GATGTTAAGGGTATGGATGAAGG + Intronic
1120540621 14:85746005-85746027 GGTGATAAGGGCAGAGAAGATGG - Intergenic
1122045667 14:99021396-99021418 GGTGTCATGGGGCTTGCAGAAGG - Intergenic
1122419589 14:101567062-101567084 GGTGACAAGGGCAATGAAGAAGG + Intergenic
1122866778 14:104609456-104609478 GGTGTTACTGGCTTTGAAGATGG - Intergenic
1125328151 15:38557891-38557913 TCTGTTAAGGGGATTGAATTAGG + Intronic
1125390948 15:39192230-39192252 TGACTTAAGGGGATTGATGATGG - Intergenic
1128887804 15:71304290-71304312 GGAGTGAAGGGGAAAGAAGAAGG + Intronic
1129563780 15:76598800-76598822 GGGGTTAGGGGGATAGAGGAGGG + Intronic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1133925775 16:10190855-10190877 GGGGGTAAGGGGCTAGAAGAGGG + Intergenic
1133996352 16:10751499-10751521 TTTGTTGAGAGGATTGAAGAGGG + Intronic
1135504803 16:23027253-23027275 GGTGTTAGTGGGATTGAAGAGGG + Intergenic
1136031192 16:27504294-27504316 GGTGCAAAGGGGATGGCAGAGGG + Intronic
1136085217 16:27880150-27880172 GGTGGTAAGGGGCTTGGAGGGGG - Intronic
1137590720 16:49691777-49691799 GATGTTGAGGGTATAGAAGATGG + Intronic
1141005758 16:80350178-80350200 GGTCTTATGGGGATAAAAGAAGG + Intergenic
1142622557 17:1174105-1174127 GCTGTTAGGAGGATGGAAGATGG - Intronic
1144023920 17:11261073-11261095 GGAGAGAAGGGGATGGAAGATGG + Intronic
1147741846 17:42674488-42674510 GCTGCTCAGGGGATTGAGGAAGG + Intronic
1148510507 17:48165201-48165223 GGTGTTAAAGACCTTGAAGAGGG + Intronic
1149439339 17:56661978-56662000 GGTGGTGAGGGGAGTGAAGAAGG - Intergenic
1150691979 17:67374966-67374988 GGTGTCATGGGGATTGAATTGGG + Intergenic
1151019854 17:70602454-70602476 GGTGTGAATGGTACTGAAGAGGG - Intergenic
1151186038 17:72364564-72364586 GGTGTTATGGAAACTGAAGATGG - Intergenic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152022167 17:77785785-77785807 GGTGTCAAGGGGAGGGAAGAAGG + Intergenic
1152211920 17:79007033-79007055 GGTTTTATGGGAAGTGAAGAAGG - Intronic
1153536009 18:6101966-6101988 GGTTTTATAGGGAGTGAAGATGG - Intronic
1155321756 18:24626064-24626086 ACTGTCAAGGGGATTAAAGATGG - Intergenic
1156850076 18:41715914-41715936 GGTGGTGAGGGGGATGAAGATGG + Intergenic
1158332658 18:56379996-56380018 GGGGTTAAGGAGCTTGAGGAAGG + Intergenic
1164187297 19:22881534-22881556 GGTGTTACAGGGTTTGAGGAGGG - Intergenic
1165318068 19:35068742-35068764 GGTGTGAGGGGCACTGAAGAAGG + Intergenic
1165375795 19:35440803-35440825 GGGGTTGAGGGGATTGAGGATGG - Intergenic
1165447903 19:35866717-35866739 GGTGTAAAAGAGATTCAAGATGG + Exonic
1167697617 19:51024534-51024556 GCTGGTAAGGGGATTAGAGATGG - Intronic
927444380 2:23144882-23144904 GGTGTTAAGGGGCTTATATAGGG - Intergenic
929828937 2:45332060-45332082 GGTGTTACAGGCATTGAAAAGGG - Intergenic
931268713 2:60683203-60683225 GGTGTTGGCGGGAGTGAAGACGG + Intergenic
932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG + Intergenic
932452108 2:71817715-71817737 GGTGTAAAATAGATTGAAGAGGG - Intergenic
932747754 2:74348217-74348239 GGAGGCAAGGGGAGTGAAGAAGG - Intronic
935860547 2:107324468-107324490 GGTGGTGAGGAGATTGCAGAGGG + Intergenic
936049982 2:109215441-109215463 GGTGTAAAGTGGCTTGAGGAGGG - Intronic
936276760 2:111105103-111105125 GGTGTTAAGGCAATTTAACATGG - Intronic
938104828 2:128522810-128522832 GATGAAAAGGTGATTGAAGAGGG - Intergenic
939498866 2:142956461-142956483 CGTGTTAAGGGAAGAGAAGATGG + Intronic
939891207 2:147738452-147738474 GGTGCAGAGGGGATTAAAGATGG + Intergenic
940083616 2:149832907-149832929 TGTGTTCAGGGGATTAAAGTGGG - Intergenic
942715113 2:178882864-178882886 GGAGTTGAGGGGATGGAGGATGG + Intronic
944348272 2:198695258-198695280 TGTGCTAAGGGGATGGAAAAGGG + Intergenic
948670470 2:239565209-239565231 GGTGTGAAGGAGGATGAAGAAGG + Intergenic
1168751715 20:286791-286813 GGTGGTAAGGGGAGGGAAGTGGG - Intronic
1168977546 20:1979217-1979239 AGCATTATGGGGATTGAAGAGGG + Exonic
1170398472 20:15954199-15954221 GGTATTATGGGCATTCAAGAAGG - Intronic
1172598628 20:36168166-36168188 GGTGGTTAGGGTGTTGAAGAGGG + Intronic
1173407704 20:42780987-42781009 GGGCTAAAGTGGATTGAAGAAGG - Intronic
1173693346 20:44983508-44983530 GGTGTGATGGGGGTTGAAGTGGG + Intronic
1173942502 20:46923539-46923561 AGTGTTAAAGTGATTGAAGTGGG + Intronic
1175011498 20:55742241-55742263 GGGGTTAAGGGAATTGACCAAGG - Intergenic
1175299437 20:57932469-57932491 GGGGTCAAGGGGCTTGAAGGTGG + Intergenic
1175393619 20:58643632-58643654 GGTGATAAGAGCAGTGAAGATGG + Intergenic
1177295740 21:19172772-19172794 GGTGTTAAGATGTTTGAAGATGG + Intergenic
1179973728 21:44851125-44851147 GGTTTTATGGGGAATGATGAGGG + Exonic
1182262571 22:29085328-29085350 TGTAGTAAGGGGAATGAAGAGGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949272226 3:2231358-2231380 GGAGTTAAGGGGATGGATTAGGG - Intronic
952285844 3:31969276-31969298 AGTGTTTAGGGGATGGATGAGGG - Intronic
953717813 3:45330873-45330895 GTTGTTATGGTGATGGAAGAGGG + Intergenic
954155507 3:48682877-48682899 AGTGTTGAGGGGAGTGAAGTGGG - Intronic
955036240 3:55270621-55270643 GGGGTTGAGGGGAGGGAAGAGGG + Intergenic
955236618 3:57144979-57145001 GGTGTAAATGGGAGTAAAGAGGG + Intronic
955467260 3:59250266-59250288 TGTGTTTAGGAGGTTGAAGAAGG + Intergenic
955696267 3:61640502-61640524 GGTCTTACGGGGATTAAATATGG - Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
958747487 3:98154502-98154524 GGTGTAAAGGTGGTTAAAGAAGG + Intergenic
958754017 3:98228377-98228399 GGTGTAAAGGTGGTTAAAGAAGG + Intergenic
959551924 3:107669660-107669682 GGTGCCAAAGGGTTTGAAGAGGG + Intronic
959674897 3:109023544-109023566 GGTATTAAGTGGATTTTAGATGG + Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962118171 3:132534020-132534042 GCTGTGAAGGGGTTAGAAGAAGG + Intronic
963994361 3:151690557-151690579 CGTGTTGAGGGGAAAGAAGAAGG - Intergenic
966620228 3:181955260-181955282 GGGGTTAAGGGAATTTAACAGGG + Intergenic
967308235 3:188080457-188080479 GGTGTTCAGGGGAGAGAGGAAGG + Intergenic
967349582 3:188497942-188497964 GGTGTTAAGGGGAGGAGAGAGGG - Intronic
967994287 3:195154957-195154979 GGTATGAAGGGGAGGGAAGAAGG + Intronic
968278076 3:197456148-197456170 TGGGTCTAGGGGATTGAAGAAGG - Intergenic
969223864 4:5781502-5781524 GGTGTAAAAGTGATTGGAGATGG + Intronic
969312487 4:6362040-6362062 GGGGGTGAGGGGGTTGAAGAGGG + Intronic
971924351 4:32987600-32987622 GTTGATAAGGGTATTGATGAAGG + Intergenic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
978474405 4:109109688-109109710 GGGGTTAAGGGCATTTCAGATGG - Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
980475587 4:133310239-133310261 GGTGTTAAAGAGAAAGAAGAAGG - Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
986071639 5:4290758-4290780 AGTGTTAAGGGGCTTGGCGATGG - Intergenic
986678622 5:10213075-10213097 TGTGTGAAGGGGAATGATGAAGG - Intergenic
988006278 5:25416001-25416023 GATGTTAAGGGGATGGAACTGGG - Intergenic
988253637 5:28794822-28794844 GATGTTAAGGTGATTGAACCAGG - Intergenic
988874294 5:35427040-35427062 GGTGCTAAGGTGATGAAAGAGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992222017 5:74582539-74582561 GGTGATTGGGGAATTGAAGAGGG - Intergenic
993401786 5:87462333-87462355 GGTGATAAAGAGATTGATGATGG - Intergenic
993543969 5:89188161-89188183 GGTGTTCAGAGGATTCAATAGGG - Intergenic
997291059 5:132735984-132736006 AGTGAAGAGGGGATTGAAGATGG - Intronic
999405462 5:151303133-151303155 CGTGTTAAGGAGATAGATGAAGG + Intronic
999855074 5:155585666-155585688 TGTGTTAAGAGGATTCATGAAGG + Intergenic
1001397478 5:171427709-171427731 GGTTTTGAGGGGAATGAAGAAGG + Intronic
1005272949 6:24185853-24185875 GGAGTGAAGGGGATGGAGGAAGG - Intronic
1005273301 6:24189329-24189351 AGTGGTAAGGGGAAAGAAGATGG + Intronic
1006379558 6:33689574-33689596 GGTGTTGAGGGAAAGGAAGAAGG - Intronic
1006576192 6:35048259-35048281 GATGTAAAGGGGATTGAAGTAGG + Intronic
1010665141 6:78620154-78620176 GGTGTTCAGAGGAATGAAAAGGG - Intergenic
1010750181 6:79608789-79608811 GGTGGTAAGGGGAATGAAGCAGG - Intergenic
1010949524 6:82018660-82018682 AGTGTTAAGGGGTAAGAAGAAGG - Intergenic
1011971856 6:93235474-93235496 GGTGGTGGGGTGATTGAAGAAGG - Intergenic
1014788756 6:125647198-125647220 GGTGTTAAGGGCATAGAAATGGG - Intergenic
1014913921 6:127121414-127121436 TGTGTTGAGGGGATGAAAGAAGG + Intronic
1018994486 6:168700866-168700888 GGTGGCAGGGGGATTGAAAAGGG + Intergenic
1021122714 7:16815205-16815227 GGTGAGAGGGAGATTGAAGAAGG + Intronic
1021555632 7:21915193-21915215 GGAGTCAAGGAGATGGAAGAGGG + Intronic
1023837163 7:44074951-44074973 GGTGGTAAAAGGATGGAAGATGG + Intronic
1024889197 7:54181674-54181696 GGTGTTTAGGGCCTTGAAGTGGG + Intergenic
1026251690 7:68676727-68676749 GGTGGGAAGGGGAAGGAAGAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027663901 7:81020684-81020706 GGTGTTAAAGGGTTTGGTGATGG - Intergenic
1029932156 7:104383790-104383812 CTTGTTAGGGGGAGTGAAGAAGG + Intronic
1030107519 7:105999505-105999527 GATGTTTAGGGGATAGAAGCTGG - Intronic
1032144052 7:129362725-129362747 TATGATAAGGAGATTGAAGAAGG + Intronic
1032805976 7:135354677-135354699 GCTGATAAAGGGATTGAAAATGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034444329 7:151105030-151105052 TGTGTTAAGGAGAGGGAAGAGGG + Intronic
1034553994 7:151838332-151838354 GGTGCTGAGGGGATTGAGCAAGG - Intronic
1037081552 8:14793656-14793678 GGGGTAAAGGGGATTGCAAATGG + Intronic
1037784254 8:21893175-21893197 GGTGTTGTGGGGGTTGCAGAGGG - Intergenic
1040021482 8:42745096-42745118 AGTCTAAAGGGGATGGAAGAGGG + Intergenic
1040632475 8:49231261-49231283 TCTGTGAAGGGAATTGAAGAAGG + Intergenic
1041712347 8:60906078-60906100 GGTGTTTGAGGGAATGAAGAAGG - Intergenic
1042441717 8:68835508-68835530 GGAGTTTAGGGGATTCAGGAAGG + Intergenic
1042629167 8:70797689-70797711 GGAGGTTAGGGGAGTGAAGATGG - Intergenic
1044317198 8:90763642-90763664 CGGGTTAAGGGGATAGAAGAGGG + Intronic
1045337696 8:101223738-101223760 CATGATAAGGGGATTAAAGAAGG + Intergenic
1048415491 8:134223748-134223770 GGTGGTAAGGGCAGTGAGGATGG + Intergenic
1050845606 9:10213976-10213998 GGGGTTAAAGGGATTGAAATAGG - Intronic
1052146388 9:25054909-25054931 AGTGTGAAGGGGATTGAATTAGG + Intergenic
1052343124 9:27382477-27382499 GGGGTGAAGGGGGTTGGAGAAGG - Intronic
1054971254 9:71090177-71090199 GATGGTGAGGGGATTGAACAAGG + Intronic
1055403947 9:75954619-75954641 CCTGTTAAGGAGATTGAAGTGGG + Intronic
1056903858 9:90627512-90627534 GGGGCTAAGGGAATGGAAGAAGG + Intronic
1058410862 9:104729852-104729874 GGTCTTATGGGAATTGAATAAGG + Intergenic
1058654569 9:107208121-107208143 GGTGTTTGGGGAATGGAAGAGGG - Intergenic
1058768792 9:108210159-108210181 GGTGGCCAGGGGATAGAAGACGG - Intergenic
1058852150 9:109023199-109023221 GGTGTTAGGGTGATTGATGGAGG + Intronic
1059336902 9:113574787-113574809 GGTGGGAAGGGGAGTGAGGATGG + Intronic
1059410225 9:114127129-114127151 GGTGGGAAGGGGAGTGGAGAGGG + Intergenic
1060430612 9:123548285-123548307 AGTGTAAAGGGGACTGCAGAAGG - Intronic
1060790278 9:126481322-126481344 GGCATTAAAGGTATTGAAGATGG - Intronic
1061714672 9:132511249-132511271 GGAGTTCAGGGGACTGAAGGAGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186842074 X:13494387-13494409 GCTGTTCAGTGGATTGTAGAAGG + Intergenic
1187614153 X:20974928-20974950 GCTGTTAAGAGGATTGAGGGTGG + Intergenic
1188460004 X:30414322-30414344 GTTGCCAAGGGGATTGAAGGAGG + Intergenic
1188550993 X:31364401-31364423 GGTGTTAAGAGGATGGCAGGTGG + Intronic
1189212803 X:39299103-39299125 GGATTTAAGGGGTTTGAAGGAGG - Intergenic
1189357031 X:40317836-40317858 GGAGGAAAGGGGATTAAAGAAGG + Intergenic
1189917663 X:45872668-45872690 GGTGTGAAGGGGACTGCACAGGG + Intergenic
1190378979 X:49819624-49819646 TGTTTTAAGGACATTGAAGAGGG + Intergenic
1192004886 X:67199842-67199864 GGTGAGAAGGGGAAAGAAGATGG + Intergenic
1194534684 X:95091687-95091709 GGGGTTAAGGGGAATGGGGAAGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1198066058 X:133097741-133097763 GGTGATAAGAGGACTGAGGAAGG + Intergenic
1201856708 Y:18552567-18552589 GGTGTCAAAGGAAGTGAAGACGG + Intronic
1201876613 Y:18767813-18767835 GGTGTCAAAGGAAGTGAAGACGG - Intronic