ID: 1104650030

View in Genome Browser
Species Human (GRCh38)
Location 12:130524847-130524869
Sequence GAAAAGAAGGTGCCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104650030 Original CRISPR GAAAAGAAGGTGCCACATTC TGG Intronic
901258256 1:7850646-7850668 GAAAAGAAGGTTGCACAGGCCGG + Intronic
902680893 1:18043024-18043046 GGAAGGAAGGTGCCACCTTAAGG + Intergenic
902689441 1:18100966-18100988 AAAAAGAAGGAGCCACAGTGTGG + Intergenic
902852000 1:19166188-19166210 CAAATGAAGGTGCCACATGTTGG - Intronic
903750707 1:25618492-25618514 GGAAAGAAGGTGGGACATTTGGG - Intronic
904912811 1:33947976-33947998 AGAAAGAAGGTGCCAAAGTCAGG - Intronic
905589867 1:39153925-39153947 CAAAAGCAGGTGCCAGGTTCAGG - Intronic
907547886 1:55277995-55278017 AAAAATAAGGTGGAACATTCAGG + Intergenic
907721291 1:56974672-56974694 GAAAACCAGTTACCACATTCAGG + Intergenic
907971412 1:59385233-59385255 GAAAAGTAGCTGCCATATTTCGG - Intronic
908104012 1:60822441-60822463 GAAAAGAAGGTGAAGCAGTCAGG + Intergenic
908498502 1:64719255-64719277 AAAAAGAAGCTGCCCTATTCTGG + Intergenic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
913476373 1:119242309-119242331 CTATAGAATGTGCCACATTCTGG - Intergenic
914840571 1:151245180-151245202 GAAAACCAGGTGGCACCTTCAGG + Intronic
919687357 1:200496660-200496682 GAAAAGATGGTGGGATATTCTGG - Intergenic
922371232 1:224912150-224912172 GAAAGGGAGGTTCCAGATTCAGG - Intronic
922768582 1:228169355-228169377 TGAAAGAAGGTGCTACATTCAGG - Intronic
923301108 1:232641468-232641490 GTACAGAAGGGGCCACTTTCAGG - Intergenic
924383258 1:243482495-243482517 GAAAAGCAGCTGCCCCATGCAGG - Intronic
1062811694 10:471191-471213 GAAAAGCTGGTGCCACCTCCTGG - Intronic
1064617913 10:17181866-17181888 GAAAAGGAGGGGCCAGATGCTGG - Intronic
1065803023 10:29369854-29369876 GAAAAGAGGCTGCATCATTCTGG - Intergenic
1067779713 10:49190893-49190915 GAAAAGAATGAGCCCCACTCCGG + Intergenic
1069324674 10:67218556-67218578 GAAAACAAGGTGTTACATTTGGG - Intronic
1071494202 10:86156535-86156557 GAAAACAAAGGGCCACATTTGGG + Intronic
1072277098 10:93833987-93834009 GAAAAGAAAGGGCCATTTTCAGG - Intergenic
1075311689 10:121419697-121419719 AAAGAAAAGGTGCCTCATTCGGG + Intergenic
1076407691 10:130223900-130223922 GAAAAGAAGATGCAACATTAGGG - Intergenic
1077655756 11:4017240-4017262 GAAATGAAGCTGCAACAATCAGG - Intronic
1078940521 11:15999632-15999654 GAAAAGTAGGTGACATATTCAGG + Intronic
1079091378 11:17482724-17482746 GCAAAGAAGGTGTCAGAGTCCGG + Intergenic
1079573133 11:21969319-21969341 GAAAAGAATTGTCCACATTCAGG + Intergenic
1080910950 11:36598014-36598036 GGAATGAAGATGCCACATTTTGG - Intronic
1081375128 11:42349548-42349570 GAATTGAATGTGCCACCTTCCGG - Intergenic
1082670059 11:56024708-56024730 GAAAAGTAGCTGCCACTGTCAGG + Intergenic
1086589191 11:88492182-88492204 TAAAGGAAGTTGCCACTTTCGGG - Intergenic
1086771815 11:90775784-90775806 GACAACCAGGTGCCACATTTCGG - Intergenic
1087199631 11:95332550-95332572 GAAGAGAAGGTGCCTCAACCAGG + Intergenic
1088207574 11:107412091-107412113 GAAAAAAATGTGCCTGATTCAGG + Intronic
1090691151 11:129183565-129183587 GAAGAAAAAGTGCCACTTTCAGG - Intronic
1093789455 12:23231091-23231113 GCAACGAAGGTGTGACATTCTGG - Intergenic
1094069203 12:26394599-26394621 AAAAAGAAGGGGCCAGATTGTGG + Intronic
1096501272 12:52065176-52065198 GAATAAAAAGTGACACATTCAGG - Intergenic
1098289135 12:68938467-68938489 GAAACAAATGTGCCACATTAGGG - Intronic
1099237864 12:80103431-80103453 GAAGAGAAGGGACAACATTCTGG - Intergenic
1099792642 12:87356415-87356437 GCAAAGAAGTTCACACATTCAGG + Intergenic
1100231812 12:92616630-92616652 GAAAAGAAGGTGCTTCAGGCAGG - Intergenic
1100376029 12:94017249-94017271 GAAAAGAAGAACCCACTTTCTGG + Intergenic
1101014410 12:100484712-100484734 TAAAAGAAGGAGAAACATTCAGG - Intronic
1102219462 12:111184761-111184783 GAAAAGAAAATGACACATTGCGG + Intronic
1103043464 12:117715332-117715354 GAAAATAAAATGCAACATTCAGG + Intronic
1104650030 12:130524847-130524869 GAAAAGAAGGTGCCACATTCTGG + Intronic
1106781668 13:33064668-33064690 GAAAAGAAGATGGCAGATACAGG + Exonic
1108071951 13:46637210-46637232 GACAAGAAGTGGTCACATTCAGG - Intronic
1108570245 13:51742442-51742464 AAAAAAAAGGTTCCAGATTCCGG + Intronic
1110440499 13:75520848-75520870 GAAAAGAAAATCCCATATTCAGG + Intergenic
1111280567 13:86017497-86017519 GATAAATAGGTGCCACAATCTGG + Intergenic
1111418664 13:87980364-87980386 GAAAACAATGTGCCCCATTTTGG + Intergenic
1111615007 13:90652044-90652066 GAAAAGAAAGTCCCATTTTCTGG + Intergenic
1111753117 13:92358986-92359008 GAAAAGAAAAACCCACATTCAGG - Intronic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1116244464 14:42392148-42392170 GAAAAGTAGTTACCACAGTCTGG + Intergenic
1117989700 14:61421644-61421666 GAAAAGAGCTTGCCACATTCAGG - Intronic
1119115078 14:72012634-72012656 GAAAGGAAGGTGCTACTTTTAGG - Intronic
1120859553 14:89242431-89242453 GAATGGAAAGTGCCACCTTCAGG - Intronic
1121396447 14:93627892-93627914 AAGAAGAAGGTGCCACATTCTGG - Intronic
1122172888 14:99891290-99891312 GAAAAGAAGTAGCCAGCTTCAGG + Intronic
1122710860 14:103656759-103656781 GAAGAAAAGGTCCCACCTTCTGG + Intronic
1122868102 14:104618698-104618720 AAAAAGAGAGTGCCACATTAAGG - Intergenic
1123108860 14:105855905-105855927 GAAAAGAACGTGCCTCTTCCAGG - Intergenic
1124258473 15:28165143-28165165 GTGAGGAAGGTGCCACACTCTGG + Intronic
1125297275 15:38216852-38216874 GAAAACAAGGTAGCACATTCAGG - Intergenic
1125496396 15:40198554-40198576 GAAAAGAGGAAGCCACAATCAGG + Intronic
1127152815 15:56095620-56095642 GACCAAAAGGTTCCACATTCAGG - Exonic
1128407520 15:67358185-67358207 GAAAAGAAAGTGCCTCATGATGG - Intronic
1132713870 16:1280971-1280993 GAAAAAAAGTTGCAACATTCTGG + Intergenic
1133269485 16:4603592-4603614 GAAAGGAAGGTCCCACCTTGAGG + Intergenic
1134018327 16:10904712-10904734 GAGAAGCAGGTGCCAGATTTAGG - Intronic
1138295933 16:55885198-55885220 GAAAAAAATGTCCCACATTAGGG - Intronic
1139031941 16:62894337-62894359 GAAGACAATGTGCCACAGTCTGG + Intergenic
1139294464 16:65888131-65888153 GAAAAGAAATGGTCACATTCAGG + Intergenic
1140816288 16:78623920-78623942 GCAAAGACTTTGCCACATTCTGG - Intronic
1144692381 17:17276386-17276408 GAGAAAAAGGTGAAACATTCAGG - Intronic
1147592931 17:41696714-41696736 GTTTAGAAGGGGCCACATTCGGG + Intergenic
1148118003 17:45189092-45189114 GAAAAAAAGTTGCAACATTGTGG + Intergenic
1149527742 17:57369876-57369898 GAAAGGAAGGGGCCATAGTCTGG + Intronic
1150055404 17:62010223-62010245 AAAAAAAAGGTACCAAATTCAGG + Intronic
1151959606 17:77398664-77398686 GAACAGGAGGCGCCCCATTCCGG - Intronic
1153030834 18:711855-711877 GTAATGAAGGTGTCACAGTCGGG - Intronic
1153490352 18:5640769-5640791 GGAGAGAAGGTGGCACATTGTGG + Intergenic
1155060019 18:22220030-22220052 CAGAAGAAGGTTCCACATTCAGG - Intergenic
1156368573 18:36451950-36451972 GAAAAAAAGGAGCCACATGCAGG - Intronic
1156644618 18:39146160-39146182 GAAAGGAAGGTGCCACAGTGGGG + Intergenic
1157730404 18:49999464-49999486 GAAAAGAAGGAGTCAAATTATGG + Intronic
1158184001 18:54750812-54750834 GGAAACAAGGTGCCATTTTCTGG + Intronic
1158218287 18:55123161-55123183 TAAAAGAAGGTTTCACATTTTGG - Intergenic
1158912485 18:62078993-62079015 GAAAAGAAGGGGCCACAGATAGG - Intronic
1160328038 18:77968454-77968476 CATAACAAGGTGCCACAATCTGG - Intergenic
1164610844 19:29630618-29630640 GAATAGAAAGTGCTACCTTCAGG + Intergenic
1165931247 19:39360672-39360694 TAAAGGAAGGTGCTACTTTCTGG + Intronic
1166635833 19:44451371-44451393 GTAAAGAAGCTGTAACATTCCGG + Intergenic
1166723915 19:45013855-45013877 AAAAAGAATATCCCACATTCTGG + Intronic
927186119 2:20483861-20483883 GAAAAGAATGAACCTCATTCAGG - Intergenic
927772946 2:25879297-25879319 TAAGAGAAGATGCCACATTCTGG - Intergenic
929786888 2:44999909-44999931 GAAACGAAGGTGCCAGGATCAGG - Intergenic
929873271 2:45775596-45775618 GAAGAGAAGGGGTCAGATTCTGG - Intronic
929886120 2:45880036-45880058 GAAAAGAAGATGCTAGATACTGG - Intronic
932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG + Intronic
932682540 2:73838155-73838177 GAAAAAAATTTGCCACTTTCAGG - Intronic
937659550 2:124414912-124414934 GAAGAGAAGGTTCCACAGTTAGG + Intronic
938083013 2:128380285-128380307 GAACAGGAGCTGCCACATCCGGG - Intergenic
940808987 2:158221597-158221619 GAAAAGAAAATGCCACCTTAGGG - Intronic
942132540 2:172894708-172894730 GAAAAGTGGGTGCCAAAGTCTGG + Intronic
942698502 2:178675703-178675725 GAAAAGAAGGTCCCTCCTCCTGG - Exonic
945700239 2:213160617-213160639 GAGAACAAGGTGCCAGAATCCGG + Intergenic
945856186 2:215072568-215072590 GAAAAGACGGAGCTACATTTTGG - Intronic
947941878 2:234064067-234064089 GAGAAGAATGTGGCACATACAGG - Intronic
1168837498 20:887538-887560 GAAAAAAAGCTGCCAAAGTCAGG - Intronic
1170238097 20:14130705-14130727 GAAAAGAAGGCTTCACAGTCGGG + Intronic
1170512310 20:17090830-17090852 CAAGAGAAGGTGCCAGAATCGGG + Intergenic
1171446139 20:25206038-25206060 GGAAAGCACGTGCCACATGCGGG - Intronic
1173215506 20:41078514-41078536 GAAAAGCAGGTGCCCTCTTCAGG + Intronic
1173364968 20:42376783-42376805 GAAAAAATGGTGACAAATTCTGG + Intronic
1173503356 20:43568992-43569014 GAAAAGAGGGTGCGACATCCAGG + Intronic
1174107589 20:48173713-48173735 GAAAAGAAAGTGCAACCTTATGG - Intergenic
1177867881 21:26534736-26534758 GAAAATATGGTGCAATATTCTGG - Intronic
1177962233 21:27681413-27681435 GTAAAGGAGATGCCCCATTCTGG - Intergenic
1178040637 21:28637011-28637033 TAAAAGCAAGTGGCACATTCAGG + Intergenic
1178954230 21:37008262-37008284 TAAAAGACGATGCCACTTTCTGG - Intronic
1179072112 21:38081271-38081293 GAAAAGAAGCTGCCCCAGCCAGG - Intronic
1181658265 22:24319051-24319073 GTAAAAGAGGTCCCACATTCAGG - Intronic
1182731033 22:32493768-32493790 GAAAAAAAAGTTCCACAATCAGG - Intronic
1182769883 22:32787017-32787039 AAAAAGAAGTTGGCACATTCGGG - Intronic
1183347081 22:37313804-37313826 GAAGAGAAGTTGCAGCATTCTGG - Exonic
949791761 3:7800619-7800641 GAAAAGATAGTGCTACATTTTGG + Intergenic
955803083 3:62706095-62706117 GAAAAGCAGCTGCCACACTCTGG - Intronic
956444833 3:69315819-69315841 GAAAAGCAGGGGCAACATTTTGG + Intronic
959515899 3:107266788-107266810 GAAAAGAAACTGCCTCATACTGG - Intergenic
960289760 3:115869487-115869509 GCAAAGAAGATGCCACTATCTGG + Intronic
963112995 3:141701931-141701953 GAATAGAAAGTGCCATTTTCGGG + Intergenic
963610697 3:147464269-147464291 CAAAAGAGTGGGCCACATTCAGG + Intronic
964311466 3:155398167-155398189 GAAAAGAAAGTTACACATTCTGG + Intronic
964458242 3:156892564-156892586 TAAAAGAAGATGGCATATTCTGG - Intronic
967593145 3:191301089-191301111 GGAAAGAAGGTGACATATTTTGG - Intronic
967810535 3:193756872-193756894 TAAAAGAAGGTGACAAAATCTGG - Intergenic
969604510 4:8195833-8195855 GAGAAGGAGGTGCCACAGGCAGG + Intronic
970387046 4:15566452-15566474 GAAAGGCAGGTCCCCCATTCAGG + Intronic
971144688 4:23963821-23963843 GAAATGAAGGTGTCATAGTCGGG + Intergenic
971333862 4:25704792-25704814 GAAAAGCAGGTGCCATTTTAGGG + Intergenic
972582373 4:40406384-40406406 GAAAAGAAAGTCCCATTTTCTGG + Intergenic
974509650 4:62822240-62822262 GAAAACAAGATGACACATTTTGG - Intergenic
975350074 4:73336002-73336024 GAAAAGAAGGTGGAACACACAGG + Intergenic
975916023 4:79326043-79326065 GAAAAGATGGTGCCAAACTGCGG + Exonic
978969324 4:114783777-114783799 GAAAAGATAAGGCCACATTCAGG - Intergenic
979347855 4:119610192-119610214 GAAGTGAAGGTGACACACTCTGG + Intronic
979629461 4:122883741-122883763 GAAAACAATGTGCAACTTTCTGG - Intronic
983107938 4:163713201-163713223 GAAAATAAGTGGCCACTTTCCGG + Intronic
983538541 4:168884021-168884043 CAAAAGAAGGTGCCACTTCAGGG + Intronic
985960141 5:3295694-3295716 GCAAAGAAGATTCCTCATTCTGG - Intergenic
986732462 5:10645339-10645361 GGAAAGGAAGTGACACATTCAGG + Intronic
988411131 5:30887201-30887223 GAAAAGTAAGTTCCACACTCAGG - Intergenic
991518651 5:67469006-67469028 AAAAAGAAGATGCCACTTTGTGG - Intergenic
991923630 5:71682553-71682575 AAAAAGAAGGTGACATTTTCAGG - Intergenic
991962183 5:72056168-72056190 GAAGACAAAGTGCTACATTCAGG - Intergenic
993386076 5:87265009-87265031 GAAATGAAGTTGGCTCATTCTGG - Intergenic
994149272 5:96430137-96430159 GAAAAGAACATGCTACATTTAGG + Intronic
995335734 5:110997508-110997530 GAAAAGAAGGTGACTATTTCAGG - Intergenic
995832679 5:116371480-116371502 GAAAAGAAAGTGCCAATTTATGG + Intronic
996195873 5:120606196-120606218 GAAAGGATGCTGGCACATTCTGG - Intronic
997387405 5:133484112-133484134 GCAGAGAAGGTGCCACACCCAGG - Intronic
997460890 5:134051552-134051574 GAACAGATGGTGTCACATCCAGG - Intergenic
998004983 5:138650937-138650959 GGAAAGAAGTTGCCATTTTCGGG + Intronic
998315458 5:141179174-141179196 GAAAATAAGTTGCTCCATTCAGG + Exonic
998760426 5:145426077-145426099 GAAAAGAAGGGGCCTCAGTCAGG + Intergenic
1000638057 5:163666213-163666235 AAAAAGAAGTTGTCAGATTCTGG - Intergenic
1001251976 5:170153479-170153501 GAAAAGCAGGTCCCACTCTCCGG - Intergenic
1003640366 6:7870524-7870546 GAAAAGAAGGTGGCAGAGACAGG - Intronic
1004996512 6:21198869-21198891 GAAAAGAGAGTGCCTCTTTCAGG + Intronic
1005817774 6:29570312-29570334 GAAAAGAATGGGACACACTCAGG + Intronic
1008283194 6:49620503-49620525 GAAACTATGGTGCCCCATTCAGG - Intronic
1008571625 6:52822227-52822249 GAAAAGAAAATCCCACTTTCAGG - Intergenic
1012204415 6:96442772-96442794 AAAAAGAAAGTGCCACCTCCTGG + Intergenic
1012446971 6:99316486-99316508 GAAAGGCAGGTGCCACATTGCGG - Intronic
1015413207 6:132917998-132918020 GAAAAGAAGTGGACAGATTCTGG - Intergenic
1015479324 6:133690580-133690602 CAAAGGATCGTGCCACATTCAGG + Intergenic
1015693635 6:135955761-135955783 GAACAGAAGGTGCAAAATACAGG + Intronic
1015922261 6:138278164-138278186 GAAAAGAAGGTGAGACTTACAGG + Intronic
1017867851 6:158460025-158460047 GAAAAAAACCTGCCACAATCAGG - Intronic
1018358577 6:163043017-163043039 AAAAAGAAGGTGTCACTTTCTGG + Intronic
1018737832 6:166702172-166702194 GAAAAGAAGGTGCCACCATTCGG - Intronic
1020501973 7:8934776-8934798 GAAAAGAGGATGCAACATTTTGG + Intergenic
1021704253 7:23351331-23351353 GAAAAGAAGGTGCCACCATTCGG - Exonic
1021989353 7:26127158-26127180 GAAAAGAAGTTGCCAGATTGAGG - Intergenic
1022790313 7:33681898-33681920 GAAAAGAATATTCCACATTATGG + Intergenic
1022797721 7:33745413-33745435 GAATAGAAGGTGCCATCTTGAGG + Intergenic
1023052307 7:36263629-36263651 GAAGAGAAGATGTCACGTTCTGG + Intronic
1023475334 7:40572064-40572086 GGAAACAAGATGCCACATTCGGG - Intronic
1027697790 7:81432861-81432883 GAAAAGGTGGGGCCACATCCGGG - Intergenic
1028655688 7:93203854-93203876 GAGATGAAGGTGCCACGTTGAGG + Intronic
1029642344 7:101829027-101829049 GAAAAGTGGGTGCCAAAGTCTGG + Intronic
1030549814 7:110944354-110944376 GAGAAGGATCTGCCACATTCAGG + Intronic
1031357732 7:120808575-120808597 GAATAGACTGTGCCACACTCTGG - Intronic
1032889369 7:136178121-136178143 TAAAACAGGGTGCAACATTCTGG + Intergenic
1033967289 7:146991666-146991688 GAAAAGAAAGTGCAACATAATGG + Intronic
1034274859 7:149819606-149819628 GAGATGAAAGTGCCACACTCAGG - Intergenic
1034398482 7:150846006-150846028 GATGAGAAGTGGCCACATTCTGG - Intronic
1034874589 7:154713871-154713893 GAAAAGAAAATCCCACTTTCTGG - Intronic
1038713772 8:29973451-29973473 GAAACAGAGGTGACACATTCTGG - Intergenic
1039243377 8:35581326-35581348 GGAGACAAGGTGCCACATTAAGG - Intronic
1043319310 8:78962517-78962539 GAAAAGAAGGTACCAATTGCTGG - Intergenic
1043551577 8:81379049-81379071 AAAAATCAGGTGCCACATGCAGG + Intergenic
1043942744 8:86213918-86213940 AAAAAAAAAGTGCTACATTCTGG + Intergenic
1046178303 8:110608412-110608434 AAATAGAATGTGCCACATTTGGG - Intergenic
1046308170 8:112398255-112398277 GCAGGGAAGGTCCCACATTCTGG + Intronic
1047313000 8:123708198-123708220 GAAAAGAAGGAGCCACACACTGG + Intronic
1048680914 8:136840662-136840684 CAAAAGAAGGTGCAAAATTGAGG + Intergenic
1049444747 8:142624779-142624801 GAAAGGAAAGGGGCACATTCAGG - Intergenic
1050764178 9:9111948-9111970 GAAAAGAAGGTGCAAAAATGGGG + Intronic
1051813203 9:21074249-21074271 GAAAAGAACATGCCACAGACTGG - Intergenic
1052383961 9:27803285-27803307 GAAAAGAAGAGGGCAGATTCAGG + Intergenic
1054926816 9:70597723-70597745 GATAAGAAGGAGCATCATTCTGG + Intronic
1056662491 9:88554760-88554782 GAAAAAGAGGAGCCTCATTCAGG - Intronic
1057315596 9:93966456-93966478 GAGAACAAGGGGCCACATTCTGG + Intergenic
1058873515 9:109222641-109222663 GGAAAGGAGGTCCCACATCCTGG + Intronic
1059093592 9:111388488-111388510 GACAGGAAGGGGCCACATTACGG + Intronic
1059759605 9:117325512-117325534 GAAAAGGAGATTCCAAATTCAGG - Intronic
1061401530 9:130370935-130370957 ACAAAGAAGAAGCCACATTCAGG - Intronic
1190634647 X:52421700-52421722 GAAAACAAGTTCACACATTCAGG - Intergenic
1193070632 X:77302238-77302260 GACAACCAGGTGCCACATTTCGG + Intergenic
1193354859 X:80507203-80507225 TAAAATAATGTGACACATTCTGG - Intergenic
1193677357 X:84471919-84471941 CAAAATAAGTTGCCACATTATGG + Intronic
1195506501 X:105664254-105664276 CAAATGAAAGTGCCATATTCTGG + Intronic
1195881022 X:109592767-109592789 GAACAGAAAGTGACACATCCAGG - Intergenic
1196426677 X:115576786-115576808 AAAAAAAAGGTGCAACTTTCTGG + Intronic
1200687426 Y:6268801-6268823 GACAACAAGGAGGCACATTCAGG - Intergenic
1201047848 Y:9905909-9905931 GACAACAAGGAGGCACATTCAGG + Intergenic