ID: 1104651387

View in Genome Browser
Species Human (GRCh38)
Location 12:130536955-130536977
Sequence AACACAAGACAACCCCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104651380_1104651387 28 Left 1104651380 12:130536904-130536926 CCTCTGGGGTACTTTTTCCAAAA 0: 1
1: 0
2: 7
3: 30
4: 260
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223
1104651385_1104651387 -4 Left 1104651385 12:130536936-130536958 CCCATTCTAATCACAGGAAAACA 0: 1
1: 0
2: 2
3: 41
4: 376
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223
1104651386_1104651387 -5 Left 1104651386 12:130536937-130536959 CCATTCTAATCACAGGAAAACAC 0: 1
1: 0
2: 3
3: 25
4: 250
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223
1104651381_1104651387 11 Left 1104651381 12:130536921-130536943 CCAAAAACCTAGAACCCCATTCT 0: 1
1: 0
2: 11
3: 63
4: 403
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223
1104651382_1104651387 4 Left 1104651382 12:130536928-130536950 CCTAGAACCCCATTCTAATCACA 0: 1
1: 0
2: 5
3: 31
4: 252
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223
1104651384_1104651387 -3 Left 1104651384 12:130536935-130536957 CCCCATTCTAATCACAGGAAAAC 0: 1
1: 0
2: 10
3: 72
4: 469
Right 1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104651387 Original CRISPR AACACAAGACAACCCCAAAT TGG Intronic
902390555 1:16102300-16102322 AACAAAACAAAACCCGAAATTGG - Intergenic
903236593 1:21954775-21954797 AACATCAGATAAACCCAAATTGG - Intergenic
903370833 1:22834949-22834971 AAAAAAAGGCAAGCCCAAATTGG + Intronic
904547343 1:31285806-31285828 AACATAAGACAAACCTAAATTGG - Intronic
905251770 1:36653543-36653565 AACAAAACAAAATCCCAAATTGG - Intergenic
908928671 1:69289128-69289150 AACATCAGACAAACCCAAACTGG - Intergenic
909000262 1:70209407-70209429 AACACAATACAATTCAAAATAGG - Intronic
909229317 1:73065119-73065141 AGCTCAAGAAAACCGCAAATAGG + Intergenic
909718148 1:78735443-78735465 GACCAAAGACAACCCCAAAGAGG + Intergenic
910535207 1:88289753-88289775 AACACATAACAAGCCCAAAAAGG + Intergenic
910765178 1:90775060-90775082 AAGACAAGACCACCCCAACCAGG - Intergenic
911740771 1:101384739-101384761 AACAGAAAACTTCCCCAAATTGG + Intergenic
912147051 1:106806892-106806914 AACACAAGACTGCCCAAAACTGG + Intergenic
912755706 1:112323301-112323323 AAAACAAAACAACCACAAAGAGG - Intergenic
913605757 1:120464310-120464332 GACACAACAGAACCCCAAATAGG - Intergenic
916676637 1:167069289-167069311 AATACAAGAAATCCACAAATGGG - Intronic
917819409 1:178747077-178747099 AACATAAGAAAATTCCAAATGGG - Intronic
919696956 1:200587353-200587375 AAAATAAGAAAACCCCAAAAAGG + Intronic
924010169 1:239656132-239656154 AACACTGGAGATCCCCAAATGGG + Intronic
924369213 1:243329732-243329754 AAAAAAAGACCTCCCCAAATTGG + Intronic
1064484148 10:15767356-15767378 AAAACCAGACAGCCCCAAAGAGG - Intergenic
1065861103 10:29872959-29872981 GCTACAAGACAACCCCAAAGGGG - Intergenic
1066078833 10:31909433-31909455 AACACAATTCATCCCCAAACAGG - Intronic
1066101989 10:32125839-32125861 CACGCAACACAACCCCAGATGGG - Intergenic
1068526650 10:58138145-58138167 AACCCAAGGCAACCCCACAAAGG + Intergenic
1068690607 10:59909977-59909999 AACAAAAGACAGCCCCATTTTGG + Intergenic
1069350750 10:67524060-67524082 AACATTATACAACTCCAAATGGG + Intronic
1069359600 10:67626380-67626402 AGCACAAGACATCTCCAAAGAGG - Intronic
1071101389 10:82041940-82041962 AACACAAAACTACCCCAGATGGG + Intronic
1071242645 10:83725161-83725183 AACATGAGACAACTACAAATAGG - Intergenic
1071854780 10:89613167-89613189 AACACAGAGCAAACCCAAATGGG + Intronic
1073377308 10:103047280-103047302 AACATCAGACAAGCTCAAATCGG + Intronic
1073593102 10:104774909-104774931 AACATAAAACAAGCCTAAATAGG - Intronic
1074757446 10:116634998-116635020 AACACAAAAACACCCCAAACAGG - Intronic
1075170148 10:120105735-120105757 AGCATCAGACAACCACAAATGGG - Intergenic
1078040501 11:7857986-7858008 AACACAAGAAACACCAAAATGGG + Intergenic
1079720613 11:23807586-23807608 AACATCAGACAAACCCAAACTGG - Intergenic
1080293659 11:30700454-30700476 AACATCAGACAACTCCAAGTTGG + Intergenic
1084496574 11:69508199-69508221 AACAAAAAAAAAACCCAAATAGG + Intergenic
1085823479 11:79817992-79818014 ATAACAAAAGAACCCCAAATTGG + Intergenic
1089893675 11:121906141-121906163 GACACAATTCAGCCCCAAATAGG - Intergenic
1090979505 11:131705122-131705144 ATTCCAAAACAACCCCAAATAGG + Intronic
1092993294 12:13924254-13924276 AACAGATGGCAACTCCAAATGGG + Intronic
1094634578 12:32213285-32213307 AACATCAGACAAACCCAAACTGG - Intronic
1095128060 12:38505622-38505644 ATCACAAGACATCTCCAAAGTGG + Intergenic
1095186154 12:39202368-39202390 AAAACAAGCAAACCCCAAATGGG - Intergenic
1097113620 12:56681074-56681096 AACAAAACACAACTACAAATGGG - Intronic
1097393472 12:59044347-59044369 AACATGAGACAAACCCAAATTGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102147125 12:110662399-110662421 AACACAAAACACCACAAAATAGG + Intronic
1102509081 12:113402223-113402245 AAAACAGGACATCCCCAAATCGG + Intronic
1102710653 12:114923509-114923531 AACACAAAATTATCCCAAATTGG - Intergenic
1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG + Intronic
1106124676 13:26890606-26890628 AGAACAAGCCAACCCCTAATAGG + Intergenic
1109255897 13:60081756-60081778 AAAACAAGATAACTCCAAAATGG + Intronic
1111687064 13:91515732-91515754 TACAGAAGACTATCCCAAATGGG - Intronic
1112113133 13:96324517-96324539 AACACAATTCAACCCCTAACAGG - Intronic
1112630415 13:101155453-101155475 AAGATCAGACAACCCAAAATTGG - Intronic
1113208434 13:107945016-107945038 AAAACAAAAAAGCCCCAAATCGG + Intergenic
1113572742 13:111370350-111370372 AACACCAGACAAACCCACACAGG - Intergenic
1114667179 14:24385828-24385850 AACACCAGACAATCCCAGATTGG + Intergenic
1116547952 14:46194780-46194802 AATAAAAGACAAGCCAAAATCGG + Intergenic
1119874863 14:78050128-78050150 AACCCAAGACCACCACAGATTGG - Intergenic
1120955093 14:90074752-90074774 AACAGAAGACACACCCAAAATGG + Intronic
1120965385 14:90162827-90162849 AATAAAAGACAAACACAAATGGG + Intronic
1122676440 14:103418442-103418464 AGCACCAGACAACTCCCAATAGG - Intronic
1125014871 15:34922536-34922558 AACAAAAAACAACCCCAAAACGG - Intronic
1125081492 15:35678590-35678612 AAAACATGACAACCCCAGAGAGG - Intergenic
1125893560 15:43283612-43283634 AACATCAGACAAGCCCAAAATGG - Intronic
1132278879 15:100595049-100595071 TACAAAAGTCAACCCTAAATGGG + Intronic
1134026796 16:10960392-10960414 AACATGAGACAAACCCAGATTGG - Intronic
1135003301 16:18796034-18796056 AACACATAACACCCCCAACTGGG + Intronic
1137355878 16:47763284-47763306 AACCCAATACCACCCCAAAAAGG + Intergenic
1140182823 16:72736951-72736973 AACACAAAAAAACCCCACCTTGG - Intergenic
1141008283 16:80373613-80373635 AATAAAAGACAACTCCAAAGAGG + Intergenic
1141074290 16:80988935-80988957 AACACCAGACAAACCCACGTGGG - Intronic
1141247447 16:82322332-82322354 AAGAAAAGCCAAACCCAAATTGG - Intergenic
1141370476 16:83481858-83481880 AACACAAGACAAGCCCGGATAGG + Intronic
1142097592 16:88250873-88250895 AAAACAAAAAAACCCCAAAACGG - Intergenic
1143843022 17:9749721-9749743 AACCCCAGAAACCCCCAAATAGG - Intergenic
1144183143 17:12771345-12771367 AACACAATTCAACCCATAATAGG + Intergenic
1145073666 17:19833147-19833169 AAAACAGAACAACCCCCAATTGG + Intronic
1146562490 17:33883288-33883310 AATACAAAACAGCCCCAAGTGGG + Intronic
1146765875 17:35521083-35521105 AACATCAGACAAACCCAAAAGGG + Intronic
1148797099 17:50202161-50202183 ACCAGAAGACACCCCCAAACAGG - Intergenic
1150258162 17:63766200-63766222 AAAAAAAGAGAACCCCAAAATGG + Intronic
1151599826 17:75099411-75099433 AAAACAAACAAACCCCAAATTGG - Intronic
1151950877 17:77353107-77353129 AACACAATTCAACCCACAATGGG + Intronic
1152019266 17:77771974-77771996 GGCACAAGACAACCCCAGAATGG + Intergenic
1153432342 18:5031379-5031401 AACATGAGACAAACCCAAACTGG - Intergenic
1154276485 18:12965855-12965877 TACACTAGACAACCCCAAGGTGG - Intronic
1155911933 18:31513919-31513941 AACAACAGATAAACCCAAATTGG + Intronic
1156573618 18:38286565-38286587 AATAAAAGAAAACCCTAAATGGG - Intergenic
1157227003 18:45875313-45875335 AGCATAAGACAACCCCCAACAGG + Intronic
1157635884 18:49154094-49154116 AACACCAGCCAAATCCAAATTGG + Intronic
1157926523 18:51772779-51772801 AACACAATACAACCCCCTGTTGG + Intergenic
1157957745 18:52117645-52117667 AACAAAAGAGAACCTCAAAAGGG - Intergenic
1158783066 18:60675356-60675378 AACATCAGGCAAACCCAAATTGG + Intergenic
1159552533 18:69910435-69910457 AACATCAGACAAACCCTAATTGG + Intronic
1162842672 19:13367772-13367794 AACAGAAGACACACCCAACTGGG + Intronic
1163030322 19:14539851-14539873 AACACAACCCAAGCCCAGATGGG - Intronic
1164580307 19:29430679-29430701 AACACAAGACAACACAAGAATGG + Intergenic
1164881721 19:31738533-31738555 AACACCAGACTTCCCCAAACTGG + Intergenic
1165276425 19:34756102-34756124 AACACAATACAACCAGAAATAGG + Intergenic
1165661463 19:37584191-37584213 AACACAAAACAACAGGAAATTGG + Intronic
1167279633 19:48559333-48559355 AACAAAAAACAAAACCAAATGGG - Intronic
926220447 2:10932539-10932561 ACCACCAGAAAACCCCAAAGTGG + Intergenic
927387217 2:22548660-22548682 AACAAAAAACAAACCCAAAATGG + Intergenic
927614840 2:24582622-24582644 AACCACAGACGACCCCAAATAGG + Intronic
928639812 2:33286086-33286108 AAAGCAAGACAACCCCCAAAAGG - Intronic
931170675 2:59800412-59800434 AACATCAGACAAACCCAAATTGG - Intergenic
931456565 2:62414154-62414176 TAGAAAAGCCAACCCCAAATGGG - Intergenic
931537222 2:63292161-63292183 AAGAAAAGACAAACCCAAAGAGG + Intronic
938314595 2:130317191-130317213 GACACAAAATAACCCCAAATGGG + Intergenic
938590842 2:132734847-132734869 AGCACAAGTAAACCCCAAAGTGG + Intronic
939600738 2:144187137-144187159 CAGACAAGACAACCACAAAGTGG - Intronic
939804165 2:146751931-146751953 AACACAATTCAACTCCAAAGAGG - Intergenic
940905438 2:159165166-159165188 AGCAGAAAACAACCCCAAATGGG - Intronic
943506449 2:188765991-188766013 AAAACAAAACAACCCCTACTGGG - Intronic
945676845 2:212865083-212865105 AACATAAGACAACGAAAAATTGG - Intergenic
947571338 2:231237608-231237630 CACACACGGCAACACCAAATAGG + Intronic
948151742 2:235749893-235749915 AACAGAAACAAACCCCAAATGGG + Intronic
948228591 2:236333251-236333273 TACAAAAGACAACACAAAATAGG + Intronic
948498269 2:238369541-238369563 AACACCACACAAACCCAAACCGG - Intronic
1169870524 20:10243576-10243598 AACAATAGACAAACCCAGATTGG - Intronic
1174698134 20:52580902-52580924 AAAAGAAGATAACCCCAAACTGG - Intergenic
1176692328 21:9930190-9930212 AACACCAGACAAATCGAAATTGG + Intergenic
1177690236 21:24496696-24496718 AAAACAAGACAATGCCAATTTGG + Intergenic
1178663997 21:34530986-34531008 AACAAAAAACAACCCCACAAGGG + Intronic
1181183805 22:21087133-21087155 AATTCAAGACACCCCCAAAAAGG + Intergenic
1183276129 22:36899429-36899451 AACACAATTCAACCCCTAACAGG + Intergenic
1183455613 22:37921605-37921627 AACACAAAACAACACCTGATTGG + Intronic
949153312 3:797456-797478 AACACAACAGAACCACAAAGGGG - Intergenic
952037759 3:29223225-29223247 AACCAAAGAAAACCCCAAACAGG + Intergenic
955730844 3:61984906-61984928 TACATCAGACAAACCCAAATTGG - Intronic
956028151 3:65006184-65006206 GACCCAAGGAAACCCCAAATTGG + Intergenic
957842262 3:85686861-85686883 AAGGCAAGACAACTCCAAAAGGG - Intronic
959047804 3:101493757-101493779 AACACAAGAAAACCAAAAAAGGG + Intronic
960660178 3:120049574-120049596 AACAGAAGACAAACCCAGAAAGG + Intronic
963395045 3:144721311-144721333 AAAAGAAGAAAACCCCAAAAAGG + Intergenic
966681616 3:182647382-182647404 AACAAAAGACAAACCCAGATTGG + Intergenic
967657562 3:192070105-192070127 AACATCAGATAATCCCAAATTGG + Intergenic
968545940 4:1198586-1198608 TACACAAGAGAACAGCAAATAGG + Intronic
968545944 4:1198633-1198655 TACACAAGAGAACAGCAAATAGG + Intronic
968558720 4:1264909-1264931 ACCACGAGAAATCCCCAAATGGG + Intergenic
968794366 4:2692626-2692648 AAGACAAGACAAATCCAAATTGG + Intronic
971904884 4:32713736-32713758 AACACAAAACACACACAAATAGG + Intergenic
972445655 4:39141160-39141182 AACACAAGAGAACCAGAAACAGG + Intergenic
972505918 4:39719707-39719729 AGCATCAGACAACCCAAAATTGG - Intronic
972570221 4:40303822-40303844 AACACAAGAAAATCACAAATTGG - Intergenic
974959146 4:68676627-68676649 AACCCCAGACAATCCTAAATTGG + Intergenic
978835373 4:113143069-113143091 AATAAAAGACAACCACAGATAGG - Intronic
979000600 4:115213364-115213386 AACAAAAAAGAACACCAAATTGG - Intergenic
979340784 4:119521318-119521340 AACACAAGACATCCCTAAGAAGG + Intronic
979470865 4:121094123-121094145 AAAACAAGAAAACCCCAAAACGG + Intergenic
979675866 4:123409866-123409888 GACACATGACAGACCCAAATTGG + Intergenic
980364924 4:131790428-131790450 AACACCAGACAAATCGAAATTGG + Intergenic
980917345 4:139045936-139045958 AAAACAACACAAGCCAAAATTGG - Intronic
982839545 4:160166295-160166317 AATATAAGATAAACCCAAATGGG + Intergenic
983854069 4:172619664-172619686 AACACAAAGCAACCTCAAAAAGG - Intronic
985050570 4:185987115-185987137 AACACAATACAACCCAAAGAAGG - Intergenic
986090123 5:4496169-4496191 AACATCAGACAAACCCAAACTGG - Intergenic
986548931 5:8931236-8931258 AACATCAGACAAAACCAAATTGG - Intergenic
986736357 5:10670536-10670558 AACATAAGACAATGACAAATGGG - Intergenic
987257021 5:16165599-16165621 AACATCAGACAAAACCAAATTGG - Intronic
987424466 5:17756910-17756932 AACACATTACACCCCCAAATTGG + Intergenic
989047938 5:37291235-37291257 AAAACAAAAAAACCTCAAATAGG - Exonic
990204077 5:53410100-53410122 AACAGAATTTAACCCCAAATAGG - Intergenic
992100359 5:73401763-73401785 AACACCAGACAAGCCCAAACTGG + Intergenic
992318947 5:75591784-75591806 ATCATCAGACAAACCCAAATTGG - Intronic
992834180 5:80623886-80623908 AACACAAGACAAAGCCTAAAGGG - Intergenic
993887627 5:93434803-93434825 AAAATTAGACAAGCCCAAATTGG - Intergenic
994221593 5:97201782-97201804 AACATCAAACAAGCCCAAATTGG + Intergenic
995539671 5:113172254-113172276 AACACAAAACAACTCAAAAAAGG + Intronic
997761565 5:136453423-136453445 AACAAAAGACAAAAACAAATTGG + Intergenic
997871835 5:137512890-137512912 AACATCAGACAAACCCAAACTGG + Intronic
1000387904 5:160693033-160693055 AACACTAAAAAACCTCAAATTGG + Intronic
1001533336 5:172480230-172480252 ATTACAAGACAACCAAAAATCGG - Intergenic
1003653141 6:7980375-7980397 ATAATAATACAACCCCAAATTGG + Intronic
1003659060 6:8043467-8043489 AACAACAGACAAACCCAGATTGG + Intronic
1004253007 6:14037607-14037629 AAAACAACACAACCCCAAACTGG - Intergenic
1005022243 6:21429514-21429536 CACACAGGACAACCCCAAAAGGG + Intergenic
1005697944 6:28368717-28368739 AACACCAGAGAACCCTCAATGGG + Exonic
1008228467 6:48953036-48953058 AACATAAGAAAAACCCAAACGGG - Intergenic
1008708793 6:54198033-54198055 GACAGAAGACAAGGCCAAATGGG + Intronic
1009903332 6:69836755-69836777 AAAAAAAGAAAACCCAAAATTGG + Intergenic
1010926980 6:81754970-81754992 AAAACAAGACAAGCACAAATAGG + Intergenic
1011717865 6:90125841-90125863 CCCATAAGACAACGCCAAATGGG + Intronic
1013459285 6:110359213-110359235 AACCCAAACCCACCCCAAATGGG - Intergenic
1013568849 6:111399635-111399657 AACATCAGACAAACCCAAATTGG - Intronic
1014712445 6:124823093-124823115 AACAAAAAAGAAGCCCAAATTGG - Intronic
1016112118 6:140237212-140237234 AACACAAAACATCCAAAAATAGG + Intergenic
1016205363 6:141461337-141461359 GACACAAGTCAACACCATATGGG - Intergenic
1016942269 6:149492627-149492649 AACATAAGAAAACCCCATGTCGG - Intergenic
1017588921 6:155957555-155957577 AAAACAAAACAACCTCAAAAAGG - Intergenic
1018571342 6:165213833-165213855 AATAAAAGACAAGCACAAATGGG + Intergenic
1019758761 7:2793106-2793128 AATACCAGACAAACCCAAACAGG + Intronic
1020425862 7:8065374-8065396 AATAAAAGACAGCCACAAATAGG - Intronic
1022201769 7:28124020-28124042 GACACAAGTCAGCCCCAAACAGG - Intronic
1022677803 7:32516056-32516078 AAAACAGAACACCCCCAAATGGG - Intronic
1023085842 7:36569189-36569211 AAAACAAAACAACCCCAAAGAGG + Intronic
1024119980 7:46226792-46226814 AACACCAGACAAACCCAAATTGG + Intergenic
1024813513 7:53241060-53241082 AACATTAGGCAAACCCAAATTGG - Intergenic
1024934620 7:54699756-54699778 AACACAATTCAACCCCAAATAGG + Intergenic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1027381149 7:77611110-77611132 AACACAAGACAACAAAAAAAAGG - Intronic
1027632815 7:80628844-80628866 AACACAGGACAACTCAAAGTTGG + Intronic
1027798888 7:82727038-82727060 ATCACTAGAAAACCCTAAATTGG - Intergenic
1027984849 7:85274539-85274561 AAAACAACACAAACCCATATAGG + Intergenic
1030540892 7:110829499-110829521 ATAATAAAACAACCCCAAATGGG + Intronic
1030971253 7:116059532-116059554 AAAACAAGAAAACTACAAATCGG + Intronic
1031241971 7:119257364-119257386 AACAAAAGTCAATCCCAAATAGG - Intergenic
1033113355 7:138603250-138603272 ATCACAAGACCTCCCCAAAATGG - Intronic
1037596344 8:20357517-20357539 GACACAATTCAACCCCAAACAGG - Intergenic
1038004611 8:23419030-23419052 AACACACGTCAACCCCCAACTGG - Intronic
1039371547 8:36988997-36989019 AACACTAGACAAACCTAGATTGG - Intergenic
1040573526 8:48630211-48630233 AAAACAAGAAAACCTGAAATAGG - Intergenic
1040911666 8:52525492-52525514 AAAAAAAAACAAACCCAAATGGG - Intergenic
1041390347 8:57342226-57342248 AAGACAAGACAACTCCAAGTGGG - Intergenic
1043246019 8:78002343-78002365 AACTCAAGACAGTCCCAAATAGG + Intergenic
1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG + Intronic
1045810951 8:106219396-106219418 AACAGAAGACAACTAAAAATAGG - Intergenic
1046260995 8:111767000-111767022 ATGCCAAGATAACCCCAAATGGG + Intergenic
1049018336 8:139937250-139937272 AACACAAAACGATCCCAATTTGG + Intronic
1050102257 9:2131253-2131275 AACAAGAGACAACAGCAAATAGG - Intronic
1051821543 9:21175497-21175519 AACATTAGACAAATCCAAATTGG - Intergenic
1052228422 9:26117928-26117950 AACACAACAAAACACCAAATTGG + Intergenic
1053629276 9:39916279-39916301 AACACCAGACAAATCGAAATTGG + Intergenic
1053776488 9:41547272-41547294 AACACCAGACAAATCGAAATTGG - Intergenic
1054214611 9:62334423-62334445 AACACCAGACAAATCGAAATTGG - Intergenic
1054330250 9:63746320-63746342 ATCATAAGAGAAGCCCAAATAGG + Intergenic
1054365244 9:64331213-64331235 AACACCAGACAAATCGAAATTGG + Intergenic
1054672869 9:67820924-67820946 AACACCAGACAAATCGAAATTGG + Intergenic
1054810083 9:69427620-69427642 AATACATCACAACCCCAAACTGG + Exonic
1055926117 9:81511603-81511625 AACACCAGACAAACCCAGATTGG + Intergenic
1057140238 9:92722354-92722376 TACACCAGAAAACCCCAGATTGG - Intronic
1057247092 9:93465920-93465942 AGCATCAGACAAACCCAAATCGG - Intronic
1059116633 9:111605679-111605701 AACAGCAGACAAACTCAAATTGG + Intergenic
1059792017 9:117650337-117650359 AACAGGAGAAAACCCCAAAGCGG + Intergenic
1060061741 9:120466884-120466906 AGCAGAAGACAACCCCAACCAGG + Intronic
1060075053 9:120583315-120583337 AGCAAAAGAGAAACCCAAATGGG - Intergenic
1061171074 9:128954770-128954792 AACATCAGACAAACCCAAATTGG - Intronic
1203707873 Un_KI270742v1:69036-69058 AACACAGGACAACCCCATCAGGG + Intergenic
1187107862 X:16262578-16262600 AACCCAAGGAAACCCCAATTAGG - Intergenic
1187495449 X:19791358-19791380 AGCTGAAAACAACCCCAAATAGG + Intronic
1189656792 X:43252711-43252733 AACACAATAAAACCCAGAATTGG - Intergenic
1189669998 X:43398233-43398255 AACATATAACAATCCCAAATAGG + Intergenic
1189951552 X:46236579-46236601 AACATCAGAGAAACCCAAATTGG - Intergenic
1191183755 X:57588423-57588445 AATACAAGACAACTCTATATGGG - Intergenic
1191831538 X:65420566-65420588 GACACATGACAACACCAAAAGGG + Intronic
1192235103 X:69290594-69290616 AACACAAAACAACCCCAACCAGG + Intergenic
1193971239 X:88056403-88056425 ATCACAAGTCAACCACAAAAAGG + Intergenic
1194666847 X:96685169-96685191 AACGAAAAACAAACCCAAATTGG + Exonic
1196518617 X:116644594-116644616 AACAGCAGACAAACCCACATTGG + Intergenic
1196805553 X:119581885-119581907 AACACAAGACTATCCCAATCTGG - Intronic
1199226674 X:145383994-145384016 AACACAAGACATCCTCAGTTAGG - Intergenic
1199659265 X:150031651-150031673 AACATTACACAAACCCAAATTGG + Intergenic
1200270853 X:154681408-154681430 AAAACAAAACAAACCCAAACAGG - Intronic