ID: 1104652393

View in Genome Browser
Species Human (GRCh38)
Location 12:130545211-130545233
Sequence CTCGAGATGTACCAAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104652393_1104652395 19 Left 1104652393 12:130545211-130545233 CCTGGTACTTGGTACATCTCGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1104652395 12:130545253-130545275 AGACGCGTAATTGCTGTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1104652393_1104652396 25 Left 1104652393 12:130545211-130545233 CCTGGTACTTGGTACATCTCGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1104652396 12:130545259-130545281 GTAATTGCTGTCCCAGGCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104652393 Original CRISPR CTCGAGATGTACCAAGTACC AGG (reversed) Intronic
906905396 1:49884861-49884883 CTATAGATGTAGCATGTACCTGG + Intronic
912858987 1:113196254-113196276 GTCAATATGTACCAAGTGCCAGG - Intergenic
920764758 1:208821600-208821622 CTAGAGAAGTCCCACGTACCTGG + Intergenic
1063964163 10:11332945-11332967 CTCGACACGTACCACGTACGTGG + Exonic
1072040200 10:91599902-91599924 CTCTAGTTTTAACAAGTACCAGG - Intergenic
1085397635 11:76214933-76214955 CTCGAGATGTGTCCAGGACCAGG - Intergenic
1093497560 12:19775582-19775604 CTCGAGATGGACTCAGTTCCAGG + Intergenic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1104652393 12:130545211-130545233 CTCGAGATGTACCAAGTACCAGG - Intronic
1112077505 13:95929787-95929809 CTGGAGATGTACCCAGTAATGGG + Intronic
1112192519 13:97191826-97191848 CTGGCCATGTGCCAAGTACCCGG - Intergenic
1112430091 13:99343380-99343402 CCCGTGATGTTCCAAGTATCTGG - Intronic
1117109334 14:52433693-52433715 CTGCTGATGTACCAATTACCAGG - Intronic
1121264982 14:92595798-92595820 CCCCAGATGTCCCAAGCACCTGG + Intronic
1132318775 15:100909865-100909887 CTAGAGATGTCCCAGGAACCTGG - Intronic
1137804006 16:51286752-51286774 CTTGAGATGTGACATGTACCTGG - Intergenic
1138440292 16:57030246-57030268 TTCAATATATACCAAGTACCAGG - Intronic
1142441615 16:90102086-90102108 CTCGGGATGAACCAAGGATCTGG - Intergenic
1154208691 18:12360450-12360472 CTGGGCATGTACTAAGTACCAGG + Intronic
1156154320 18:34283533-34283555 CTAGAGAGATACCAAGTTCCTGG - Intergenic
1166876918 19:45902902-45902924 CTCGGGTTGTACCCGGTACCGGG + Intergenic
929806610 2:45151860-45151882 ATTGAGATTTACCAAGCACCAGG + Intergenic
931579719 2:63759803-63759825 CTCCAGATATACCAGATACCTGG + Intronic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
942804438 2:179913102-179913124 CTTGTGATGTGCCAAGTAACTGG - Intergenic
1172151103 20:32791034-32791056 CTCCTGATGTACCAAGTCCCTGG - Intronic
1179896240 21:44365315-44365337 CTCGACAGGTACCAAGTTCAGGG - Intronic
1181857348 22:25791512-25791534 CTTGAGATCTGCCAAGCACCAGG + Intronic
949829872 3:8202518-8202540 CTAACTATGTACCAAGTACCTGG + Intergenic
950564143 3:13755536-13755558 CTGCAGATGTTCCAAGTAGCTGG + Intergenic
954387149 3:50250010-50250032 CTAGAGCTGTCCTAAGTACCTGG - Intronic
959855113 3:111144619-111144641 CTCGATATGTAAAGAGTACCTGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
962026260 3:131550905-131550927 GTCAAGATGTATCAAGTACTAGG - Intronic
963405568 3:144859318-144859340 CTCGAGATGTAAGAAGTCACAGG - Intergenic
980709748 4:136549517-136549539 CTTGAGATGTACCAAGAAAAGGG + Intergenic
992952826 5:81877300-81877322 CTCTGGATCTACCAAGTAACTGG - Intergenic
1001959912 5:175873399-175873421 CTCAGGATCTACCATGTACCAGG + Intronic
1004696243 6:18035724-18035746 CTTGAGATTTATCGAGTACCTGG - Intergenic
1005423601 6:25678422-25678444 CTAGATATGTGCCAAGTACTTGG + Intronic
1014831268 6:126105479-126105501 CTGGGGAAGAACCAAGTACCTGG + Intergenic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1045601613 8:103723595-103723617 CTCTAGATCCACCCAGTACCAGG - Intronic
1048466202 8:134666413-134666435 CTCGTGATTTTCCAAGAACCAGG + Intronic
1053381964 9:37655982-37656004 CATGAGAGGTACCAAGTATCAGG - Intronic
1056906034 9:90648655-90648677 CTGGAGATGTAGCAAGCAACTGG - Intergenic
1060735815 9:126066117-126066139 CTCCAGAAGTACCCAGTACAGGG - Intergenic
1186309970 X:8307167-8307189 CTAGAGATGTACCAAAGACGGGG + Intergenic
1196455762 X:115890552-115890574 CTTGAGATGGGCCAAGTACCTGG - Intergenic
1198687058 X:139238059-139238081 CTTGAGATGGTCCAAGTTCCTGG + Intergenic
1201756667 Y:17494029-17494051 CTGGAGATGGACCCAGTTCCCGG + Intergenic
1201844886 Y:18411955-18411977 CTGGAGATGGACCCAGTTCCCGG - Intergenic