ID: 1104652675

View in Genome Browser
Species Human (GRCh38)
Location 12:130547737-130547759
Sequence GCTTTGCTCTGAGATCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104652675 Original CRISPR GCTTTGCTCTGAGATCTCCC TGG (reversed) Intronic
900170776 1:1267651-1267673 GCATGGCTCTGTGATGTCCCCGG + Intronic
900189432 1:1347072-1347094 GCCTTGCTCTGTGTCCTCCCTGG - Intronic
900501822 1:3009651-3009673 GCTTTCCACTGAGATGTCTCTGG + Intergenic
901344727 1:8529894-8529916 GCTTTACACTGAGTTCACCCTGG + Intronic
902553973 1:17235865-17235887 GGTCTGCTCTGGGAACTCCCAGG + Intronic
902816046 1:18917366-18917388 GGCTGGCTCTGAGATATCCCAGG - Intronic
904091479 1:27947976-27947998 GTTTTGCCCTGAAAACTCCCTGG - Intronic
904268003 1:29328923-29328945 GCTCTGCTCTGTGGCCTCCCTGG + Intergenic
904429232 1:30451305-30451327 GCTCTGCTCTGTGGCCTCCCTGG - Intergenic
905003605 1:34693157-34693179 GCTCAGCTCTGAGAGATCCCTGG + Intergenic
907217823 1:52880866-52880888 CCTCTTCTCTGAGATCTCACAGG - Intronic
907859241 1:58335393-58335415 GCTTTGCTCAGAACTCTCCTGGG - Intronic
912468081 1:109887671-109887693 GCTCTGCACTGAGAGCTCACAGG + Intergenic
915079897 1:153344968-153344990 GCCTGTCTCTGAGAGCTCCCAGG - Intronic
916248498 1:162711960-162711982 GGCTTGCTCTGAGATCACCAGGG + Intronic
917902914 1:179560956-179560978 GCTTTTCTCTGAGAATTCACAGG + Intronic
919767747 1:201138225-201138247 GCTGTGCTCTGGGCTCTCCCTGG - Intronic
920243120 1:204568279-204568301 GCTCTCCTCTGAGATCGCACTGG - Intergenic
920821316 1:209384020-209384042 CCTTTGCTCTGAGTTCTGTCTGG + Intergenic
920911607 1:210223052-210223074 GCTTTGCTCTGAGAACTTTATGG + Intergenic
922746523 1:228047340-228047362 GCTTTGCACTGGCATCCCCCTGG - Intronic
922921511 1:229308994-229309016 GCTGTGCTGTGAGATGTGCCAGG - Intergenic
923339760 1:232997358-232997380 GCCTTGCTCTGGGCACTCCCAGG + Intronic
1063160708 10:3416128-3416150 GCATTGCTCTGAGAAATGCCGGG + Intergenic
1063817334 10:9790632-9790654 TCTGTGATCTGAGAGCTCCCAGG - Intergenic
1063863095 10:10333863-10333885 GCTGTGCTCTGAGATCCCTCAGG + Intergenic
1064306159 10:14168519-14168541 GTTTTGCACTGTGACCTCCCAGG + Intronic
1065246815 10:23767248-23767270 GCTTTGCTCTGAAAGCTCTGGGG + Intronic
1065490846 10:26280112-26280134 GCTGTGCTCTGAGATCACCGTGG + Intronic
1065841190 10:29702775-29702797 GCTGTTCTCTGAGCTGTCCCTGG + Intronic
1066653584 10:37680775-37680797 CCATTACTCTGAGATGTCCCTGG - Intergenic
1067095154 10:43294969-43294991 GCTCAGCCCTGAGATCCCCCCGG + Intergenic
1067381517 10:45778020-45778042 GCTTAGGTCTAAGATCTCCCAGG + Intronic
1067889216 10:50118654-50118676 GCTTAGGTCTAAGATCTCCCAGG + Intronic
1070031395 10:72680629-72680651 GCATTGCTTTTATATCTCCCAGG - Intergenic
1071800910 10:89058892-89058914 GCTTTACACTAAGTTCTCCCTGG + Intergenic
1074162470 10:110845850-110845872 GCTTTGTTCTCAGCTCTGCCTGG - Intergenic
1075594070 10:123715134-123715156 GCTGTGCTCTGTTATCTGCCTGG + Intronic
1075953207 10:126499712-126499734 GCATTGGTCTGAGATGTCCTCGG - Intronic
1076443823 10:130498315-130498337 CCTTTGCTCTGTGAGCTCACAGG - Intergenic
1076490584 10:130858766-130858788 GCATTGCACTGAAATGTCCCTGG + Intergenic
1077001879 11:327367-327389 GCTCTGCTCTGAGGTCCCCAGGG + Intronic
1077464198 11:2725827-2725849 CCTGGGCTCTGAGAGCTCCCTGG + Intronic
1078524535 11:12090427-12090449 GCTCAGCTCTGAGACCTGCCGGG - Intergenic
1079096285 11:17512559-17512581 GATTTTCTCTGGAATCTCCCAGG - Intronic
1080681889 11:34485216-34485238 GCTTTGCAATGAGAACTCTCTGG - Intronic
1081644984 11:44783986-44784008 GCTGTGCTCTGACCCCTCCCTGG - Intronic
1083012539 11:59417143-59417165 GTTTTTCTATGAGGTCTCCCCGG + Intergenic
1083484515 11:62975044-62975066 GAGTTGCTGTGAGCTCTCCCCGG + Intronic
1084643312 11:70438839-70438861 GCTTTCCTCTGAGAGGCCCCTGG - Intergenic
1085622219 11:78046072-78046094 GCTTTTCTCGGAGTCCTCCCCGG - Intronic
1086235261 11:84622609-84622631 CCTTTGCTATGAAGTCTCCCTGG - Intronic
1087871303 11:103295926-103295948 GCTTTACTCCGAGGTCTCTCTGG + Intronic
1088851632 11:113707896-113707918 GCTAGGCTCTGAGGTCTCCTAGG + Intergenic
1088863855 11:113827066-113827088 GCCTTTTTCTGAGACCTCCCAGG - Intronic
1088878659 11:113956868-113956890 GCTTTCATATGTGATCTCCCTGG - Intergenic
1089908473 11:122070959-122070981 GCTTTCCTGTGAGATCTTCTCGG + Intergenic
1092132491 12:6122584-6122606 GCTTTCCACTTAGATCTCTCAGG - Intronic
1093057190 12:14567452-14567474 GCGTTTCTCTGAGTTCACCCAGG + Intronic
1093690694 12:22105228-22105250 TCCTTACTCTGAGATCTCTCTGG - Intronic
1097919458 12:65056031-65056053 GCTTTGAACAGAGGTCTCCCTGG + Exonic
1100215572 12:92444760-92444782 GCTCTGCTCTGCTGTCTCCCGGG + Intergenic
1103243214 12:119432332-119432354 GCTTTGCCCAGAGATGTTCCAGG + Intronic
1104091288 12:125520000-125520022 GCTTTGCCCTTAAGTCTCCCAGG + Intronic
1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG + Intronic
1104531298 12:129573286-129573308 GCTTTCATCTCAGCTCTCCCTGG - Intronic
1104652675 12:130547737-130547759 GCTTTGCTCTGAGATCTCCCTGG - Intronic
1107415331 13:40194590-40194612 TCTTGGCTCTGAGAGCTTCCTGG - Intergenic
1107719485 13:43232718-43232740 GCTTTTCTCTAAAACCTCCCTGG - Intronic
1112821820 13:103346477-103346499 GCTGTGCTCAGAGATGCCCCTGG - Intergenic
1113618222 13:111695844-111695866 GCATTGCCCTGTGTTCTCCCAGG - Intergenic
1113623753 13:111781105-111781127 GCATTGCCCTGTGTTCTCCCAGG - Intergenic
1115681799 14:35747589-35747611 GCTTTGCCTAGAGAGCTCCCTGG + Intronic
1118436359 14:65774258-65774280 CCTTTGCTGTGAGAGCTTCCCGG + Intergenic
1119428271 14:74550015-74550037 GCTGTGCACAGAGATGTCCCGGG + Intronic
1121264950 14:92595538-92595560 GCTTTGCTCTGGGAGTTCCTAGG + Intronic
1121273432 14:92652326-92652348 GCCTTGCTCCGTGCTCTCCCGGG - Exonic
1121537124 14:94698605-94698627 TCTTTGTTCTGAGCTCTCCAGGG + Intergenic
1121644009 14:95505327-95505349 GCTTTACTCAGAGCTCTCCAGGG - Intergenic
1122113708 14:99517637-99517659 GCTTCGCCCTGAGCACTCCCTGG + Intronic
1122758631 14:104003119-104003141 TATTTGGTCTCAGATCTCCCTGG + Intronic
1123022089 14:105404085-105404107 GCTTTGGTTTGAGATCTCTCAGG + Intronic
1123630330 15:22256656-22256678 GCTTTGCTCTCAGCTGCCCCCGG + Intergenic
1125803080 15:42467892-42467914 GCTTTGGTGTCAGATCTGCCTGG - Intronic
1128629038 15:69244582-69244604 GCTGTGCTCTGATATGTCACAGG - Intronic
1129570610 15:76680345-76680367 TCTTTGCTCTGAAATTTACCTGG - Intronic
1129853311 15:78807878-78807900 TTTTTTTTCTGAGATCTCCCAGG + Intronic
1130720810 15:86384280-86384302 CCTTTGCCCCTAGATCTCCCTGG - Intronic
1132693666 16:1192731-1192753 TGTTTGCTCTCAGATCACCCCGG - Intronic
1133842346 16:9421157-9421179 GCTTTGCTGTGAGAGCCTCCTGG + Intergenic
1135874840 16:26188975-26188997 GCTTTGCTATGAGATCCCCACGG + Intergenic
1136390404 16:29960808-29960830 GCCTTGCTCTGTCATCGCCCAGG - Intronic
1136673535 16:31878625-31878647 ACTATGCTCTGACATATCCCTGG - Intronic
1140878741 16:79177917-79177939 GCTTTGCTCTTGGACTTCCCAGG - Intronic
1141972757 16:87493986-87494008 GCTTTGCTCTCAGCTGCCCCCGG - Intergenic
1142057168 16:88005228-88005250 GCTTTGCACTGAGGTCAGCCAGG + Intronic
1144115989 17:12091064-12091086 ACTTTACACTGAGATCTCCAGGG - Intronic
1144286532 17:13780234-13780256 ACTTTGCTCTGCCATCTCCTAGG - Intergenic
1146717806 17:35100980-35101002 ACTCTGCTCTGAGGTCCCCCAGG + Exonic
1147207865 17:38851600-38851622 GCTCTTCTCTGACAGCTCCCTGG + Intronic
1147451825 17:40510457-40510479 GCTGTGCTCTCACACCTCCCTGG + Intergenic
1150083064 17:62258844-62258866 GGTTTGAACTGAGATCTGCCAGG + Intergenic
1150368606 17:64614821-64614843 CCTTTGCTCTCAGAGCTCACAGG + Intronic
1150411936 17:64952238-64952260 GCTATGCCCTGAGATTTCCAAGG - Intergenic
1150525594 17:65919098-65919120 GCTATGCCCTCAGATCCCCCAGG - Intronic
1150627283 17:66849529-66849551 GCTGTGTTCTGGGATCTGCCTGG + Intronic
1150789323 17:68188509-68188531 GCTGTGCCCTGAGATTTCCAAGG + Intergenic
1151765505 17:76131436-76131458 GCTTTCCTCCAAGTTCTCCCTGG + Intergenic
1151830552 17:76546925-76546947 GCTTTGGTGTCAGATTTCCCAGG - Intronic
1152748142 17:82050619-82050641 GCTTGGCTCTGAGCTCTCTGCGG + Intronic
1154204869 18:12327836-12327858 CCTTGGCTGTGAGACCTCCCGGG - Intronic
1154392723 18:13954774-13954796 GCTTCAGTCTGAAATCTCCCAGG - Intergenic
1158945674 18:62445097-62445119 GCTGTGTTCTGTGATCACCCAGG + Intergenic
1160284758 18:77531119-77531141 GATCTTCTCTGAGTTCTCCCGGG + Intergenic
1161052868 19:2174182-2174204 TCCTTGGTCTGAGCTCTCCCTGG + Intronic
1161200600 19:3012684-3012706 GCTTTCCTCAGAGCTCTCCTTGG - Intronic
1161498578 19:4600629-4600651 GCTTTGCTCTGTGCACTCTCTGG - Intergenic
1162603438 19:11688341-11688363 GCTTTGCTCTGGGAGTTCCCTGG - Intergenic
1164938134 19:32230694-32230716 CCTTTGCTCTGAGCACTCACTGG - Intergenic
1167264490 19:48476982-48477004 CCTTTGGTCAGAGATGTCCCTGG - Intronic
1168372320 19:55846456-55846478 GCTTTGCTCTGAGACCATCTTGG - Intronic
925328695 2:3042183-3042205 GCAGGGCTCTGAGGTCTCCCTGG + Intergenic
926974809 2:18504010-18504032 CTTTTGCTCTGAGATTTTCCAGG + Intergenic
927126823 2:20019983-20020005 GCCTGGCTCTAAAATCTCCCAGG + Intergenic
927144225 2:20151110-20151132 GGTTTGCATTGAGATCTGCCAGG - Intergenic
929304182 2:40341137-40341159 GCTTTGCTTTGTGTACTCCCTGG + Intronic
929492377 2:42407999-42408021 GCTTTGTTCTGAGATCGGCGTGG - Intronic
930176604 2:48307249-48307271 TCTTTGTTCAGACATCTCCCAGG + Intergenic
931445184 2:62321223-62321245 TCTCTGTTCAGAGATCTCCCAGG + Intergenic
933194692 2:79375530-79375552 TCTTAGCTCTGAGAATTCCCAGG - Intronic
934738794 2:96704181-96704203 GCCATTCTCTGACATCTCCCTGG + Intergenic
934792142 2:97070405-97070427 TCTTTGCTCTGAGCTCTCTGAGG + Intergenic
934814480 2:97313304-97313326 TCTTTGCTCTGAGCTCTCTGAGG - Intergenic
934823213 2:97395179-97395201 TCTTTGCTCTGAGCTCTCTGAGG + Intergenic
935414470 2:102801259-102801281 GCTTTACCCTGAGGTCTCTCTGG - Intronic
936295679 2:111265631-111265653 TCTTTGCTCTGAGCTCTCTGAGG + Intergenic
937355371 2:121195084-121195106 GCATTGCCCTGAGTTGTCCCAGG + Intergenic
940023179 2:149177600-149177622 GCTTTGCTTTGGGATCTGCAAGG + Intronic
940039542 2:149345849-149345871 GCTTTGCTCTGAGGTCTCGTAGG + Intronic
940337376 2:152543443-152543465 GCTCTGCCCTGAGACATCCCAGG - Intronic
941228819 2:162883223-162883245 TCCTTCCTCTGAGATGTCCCAGG - Intergenic
942102945 2:172604105-172604127 GTCTTGCTCTGAGATTACCCAGG + Intronic
948699330 2:239750511-239750533 GCTTGTCCCTGGGATCTCCCTGG + Intergenic
948876619 2:240832958-240832980 GCTTTGCTCAGATGGCTCCCAGG + Intergenic
1169190888 20:3658682-3658704 GCCTTGCTCAGAGACCTCTCTGG - Intergenic
1171051524 20:21863704-21863726 GCTGTCTTCTGAGATCTCCATGG + Intergenic
1173893808 20:46534411-46534433 ACTTTGCTCTGAGATCTAAGTGG - Intergenic
1174037739 20:47678609-47678631 GTTTTGCTCTGAGTTCCCGCAGG + Intronic
1174751976 20:53120286-53120308 GCTGTGCTGTGAGATCTCTGCGG - Intronic
1174800679 20:53560668-53560690 GCTGGGCTCTGAGAGCTCCAGGG - Intergenic
1176918626 21:14658376-14658398 GCTTTGCTTTGAGACATCCCAGG - Intronic
1176976585 21:15327812-15327834 CCTTGGCTCAGGGATCTCCCAGG - Intergenic
1178388835 21:32181756-32181778 GATGTGCACAGAGATCTCCCAGG - Intergenic
1180002111 21:44999901-44999923 GCTTTGCTTTGAGATCAGCCAGG + Intergenic
1180160094 21:45995294-45995316 TCTTTGCTCTTTGAGCTCCCGGG + Intronic
1182354599 22:29716921-29716943 GCTCTGCTGGGAGCTCTCCCTGG + Intergenic
1184330173 22:43822144-43822166 GATCTCCACTGAGATCTCCCAGG + Intergenic
1184497469 22:44850306-44850328 GCCTGGCTCTGAACTCTCCCAGG - Intronic
1184767519 22:46579304-46579326 TCTTTGCTCTCCGCTCTCCCAGG + Intronic
1185217357 22:49609082-49609104 GCTTTGCGCTGAGAGCACCTGGG + Intronic
953515886 3:43591532-43591554 TCTTTGTTCTTAGAGCTCCCAGG - Intronic
954227400 3:49191109-49191131 TCTTTGTCCTGAGTTCTCCCTGG + Intronic
956225884 3:66957558-66957580 GCACTGCTCTTTGATCTCCCTGG + Intergenic
956864651 3:73357062-73357084 GTTTTCCACTGAGATCTTCCAGG - Intergenic
958879675 3:99655158-99655180 GCATTTCTCTGAGCCCTCCCTGG + Intronic
960155196 3:114291713-114291735 GGCCTGCTCTGAGAGCTCCCCGG - Intronic
961817397 3:129558320-129558342 GCTGAGCTCAGAGATCTTCCTGG - Intronic
967217452 3:187222506-187222528 GCTTGGCTCTGATATCACCGGGG - Intronic
967486963 3:190043950-190043972 GTTTTGTTTTGACATCTCCCTGG - Intronic
969449799 4:7266460-7266482 TCTGTGCTCTGAGCTTTCCCGGG + Intronic
970968037 4:21949551-21949573 GGTTTCATTTGAGATCTCCCAGG + Intergenic
972104940 4:35471828-35471850 GCTTTGCTCAGTGGTCTTCCAGG - Intergenic
972127096 4:35782185-35782207 GCCTTGTTCTGATATATCCCAGG - Intergenic
972930950 4:44071199-44071221 CCTTGGCTCAGAGAGCTCCCAGG + Intergenic
974369702 4:60999549-60999571 CCTTTGTTCTCAGATATCCCAGG - Intergenic
976025649 4:80685286-80685308 GGTTTGCTTTGAGATCTCTGAGG + Intronic
976926921 4:90510770-90510792 CCTTTGCTCTATGATCTCTCTGG - Intronic
977676032 4:99748006-99748028 GCTTTGATCTGGGACTTCCCAGG + Intergenic
978236320 4:106465356-106465378 ACTTAGTTCTGAGGTCTCCCTGG - Intergenic
980082964 4:128363714-128363736 ACTTTGATCTTAGATTTCCCAGG - Intergenic
983506707 4:168561116-168561138 TCTGTGCTCTGAGGCCTCCCTGG + Intronic
983928361 4:173426851-173426873 GCTTTACTTTGATCTCTCCCTGG + Intergenic
984121999 4:175757180-175757202 GCTTCGCTCTGACTTCTCCTAGG - Intronic
986143332 5:5052154-5052176 GCTTTGCTCTGTCATCTTCAAGG - Intergenic
988337680 5:29927445-29927467 GCTATGCTGTGAGACCTCCATGG + Intergenic
988996427 5:36719081-36719103 GCTTTGCTCTGAGAAATACAGGG + Intergenic
994593838 5:101806671-101806693 ACTTTGCTCTGAAATCTCAGTGG - Intergenic
995725160 5:115174211-115174233 GGTTTGCTCTGAGATCAGACAGG + Intronic
996019914 5:118579591-118579613 GATTTCCACTTAGATCTCCCTGG - Intergenic
996234493 5:121108866-121108888 ACTTTGCTCTGAGATCCCAAGGG + Intergenic
997125748 5:131225131-131225153 GCTTTGCTCTGGGCTTCCCCTGG - Intergenic
1001122299 5:168990807-168990829 GTTTTTCTCTAAGACCTCCCTGG - Intronic
1004089002 6:12480227-12480249 GCTTTCTTCTGAGGTCTCTCTGG - Intergenic
1006502189 6:34466126-34466148 GCGTCGCTCTGGGATCTCGCCGG - Exonic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1007109588 6:39305166-39305188 CCTTTGCTCTGGGATCCCCATGG + Intronic
1007276712 6:40679504-40679526 GCCTGGTTCTGAGATCCCCCAGG - Intergenic
1008553075 6:52651538-52651560 TCTCCTCTCTGAGATCTCCCTGG - Intergenic
1010303397 6:74287681-74287703 GCTTTTCTCAGAAATCTTCCTGG - Intergenic
1011411425 6:87070503-87070525 GCTTTTCACTGACTTCTCCCAGG + Intergenic
1012952120 6:105529430-105529452 GATTTGCCCACAGATCTCCCTGG - Intergenic
1013420563 6:109962854-109962876 GGGTTTCTCTCAGATCTCCCAGG - Intergenic
1015096296 6:129417844-129417866 GCTTTGCTCTGAAATCAGCCTGG + Intronic
1016458789 6:144260667-144260689 TCTTTTCTCTAAGAGCTCCCAGG - Intergenic
1018913310 6:168116770-168116792 GCTCTGCTCTGCGAGCTGCCGGG - Intergenic
1019057667 6:169234924-169234946 GTCTTGCTCTGAGCTCCCCCTGG - Intronic
1024027127 7:45421177-45421199 TCATTGCTCTGAGATTGCCCAGG + Intergenic
1026872378 7:73860994-73861016 GCTTTGCTCTAAGACCTCCTTGG + Intergenic
1027630468 7:80598036-80598058 GCTGTGCTCTTAGCTGTCCCTGG + Intronic
1029190940 7:98771773-98771795 GCATTGCTCTGAGATCTGCCTGG + Intergenic
1033433794 7:141313982-141314004 TCATTGCTCTCAGATCTCACTGG - Intronic
1034831309 7:154310325-154310347 GCTGTGCTCTGAGAACTGACAGG + Intronic
1039017326 8:33165673-33165695 TCTTTGCTCTGAAATCTACTTGG - Intergenic
1040783394 8:51138334-51138356 GCCCTGCTCTGTGATCTCCAAGG - Intergenic
1046856485 8:119038171-119038193 GCTTTGATATGAGATCAACCTGG + Intronic
1048480329 8:134784101-134784123 GCTTAGCGCTGTGATCTCCCAGG + Intergenic
1048677844 8:136804763-136804785 GCTTTCCTCTTTGGTCTCCCTGG + Intergenic
1049545780 8:143229872-143229894 GCTTTAATCTGATATCTTCCTGG + Intergenic
1050742937 9:8843154-8843176 CCTTTCCTCTCAGATTTCCCAGG - Intronic
1052538740 9:29779543-29779565 GCCATGCTTCGAGATCTCCCTGG + Intergenic
1053393104 9:37750432-37750454 GCTCTGCTCAGAGATGGCCCTGG - Intronic
1053456851 9:38239808-38239830 GCTTGGCTCTGAGATAAGCCAGG - Intergenic
1054711135 9:68511939-68511961 GGTCTTCTCTGAGAGCTCCCAGG + Intronic
1055771819 9:79725057-79725079 GCTTAGCTGTGACATCTCCGTGG + Exonic
1056101556 9:83304931-83304953 CCCTGGCTCTGAGATCTGCCTGG - Intronic
1056572438 9:87827818-87827840 GCTTTGTTCAGAGATTTCCCAGG - Intergenic
1056893073 9:90514129-90514151 GGGTTTCTCTGAGATTTCCCTGG - Intergenic
1060222463 9:121771960-121771982 GCTTTTCTCTGGCCTCTCCCTGG - Intronic
1060604015 9:124898153-124898175 GCCTTGCTTTAAGGTCTCCCTGG + Intronic
1061288049 9:129635448-129635470 GCTTTGCCCTGAGATGAGCCGGG + Exonic
1061322296 9:129838880-129838902 CCTTTGCTCTGAGCTCTGTCCGG - Intronic
1187237704 X:17483940-17483962 GCTTTTCTCTTGGATCTCCAGGG + Intronic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1190548697 X:51556814-51556836 ACTTTTCTCTGAGCTCTCCTGGG + Intergenic
1191015449 X:55805129-55805151 ACTTAGCGCTGAGATGTCCCTGG + Intergenic
1200926734 Y:8661498-8661520 GCTTTGCTCTCAGAAATCCCTGG - Intergenic
1201149624 Y:11088548-11088570 CCTTTGATCTGAAATCTACCTGG + Intergenic
1201910204 Y:19126001-19126023 GCTTGGTTCTGAGAACTCCCGGG + Intergenic